Tango

(redirected from ARNT)
Also found in: Dictionary, Thesaurus, Medical, Acronyms, Wikipedia.

tango

1. a Latin American dance in duple time, characterized by long gliding steps and sudden pauses
2. a piece of music composed for or in the rhythm of this dance

Tango

 

a modern ballroom dance of Argentinian origin. The tango is in duple time and has the same rhythmic form as the habanera. One of the most popular ballroom dances of America and Europe, it is also performed on the stage. The tango rhythm is used in both instrumental and vocal music. The dance is usually included in ballroom dancing courses.

Tango

(1) The code name for a minor update to Version 7.5 of Windows Phone. See Windows Phone.

(2) A phone and video calling application over Wi-Fi or cellular for Windows PCs, Windows Phone, iPhone and Android from TangoME, Inc., Palo Alto, CA (www.tango.me). Callers can record a video message if the recipient does not answer. Tango competes with the hugely popular Skype and FaceTime video calling services.
References in periodicals archive ?
Name Primer Sequence (5'-3') AHR Forward gtgcttcatatgtcgtctaag Reverse aatgagttcacatcctgaggc Oligonucleotide actgaagcagagctgcagagaccactaacag ARNT Forward cggaacaagatgacagcctac Reverse acagaaagccatctgctgcc Oligonucleotide ggtacccacctgtagggcagtttctcacatg CYP1B1 Forward gtgatgccctggctgcag Reverse aatcgagctggatcaaagttc Oligonucleotide cggccactatcactggaattggatcaggtc IL-1 [beta] Forward gcatccagctacgaatctcc Reverse ccatatcctgtccctggag Oligonucleotide gcatccagctacgaatctccggacaagctgaggaa [beta]-ACT Forward gtgcgtgacattaaggagaag Reverse gaaggtagtttcgtggatgc Oligonucleotide gagaagagctacgagcgctgccctgaggcac RT-PCR product, bp AHR 915, sample 714, IS ARNT 520, sample 430, IS CYP1B1 608, sample 510, IS IL-1 [beta] 318, sample 265, IS [beta]-ACT 213, sample 171, IS
Martin Fellowship recipient from Australia, then went on to demonstrate that reducing the level of the ARNT gene in beta cells in culture also produced defects in glucose-stimulated insulin release and alterations in islet gene expression that mimic those in humans with type 2 diabetes.
This study represents the first use of DNA chips to study islets of diabetic patients and the first demonstration of an important role for ARNT and altered gene expression in impaired beta-cell function in the pathogenesis of human type 2 diabetes," Dr.