areg

(redirected from Amphiregulin)
Also found in: Dictionary, Medical, Acronyms, Wikipedia.

areg

[′a‚reg]
(ecology)
A sand desert.
References in periodicals archive ?
In addition, the research team found that Iressa, a cancer drug that blocks the epidermal growth factor receptor, effectively stopped the proliferation caused by amphiregulin.
HER Family of Membrane Receptors Tyrosine Kinase Receptor Activity Major Ligands HER1 (EGFR) Yes EGF, amphiregulin, TGF-a HER2 Yes None HER3 No Heregulin HER4 Yes Heregulin Abbreviations: EGF, epidermal growth factor;EGFR, epidermal growth factor receptor;TGF-a, transforming growth factor a.
The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc; amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.
All 4 receptors are topologically similar, comprising 3 domains: (1) an extracellular domain that binds specific ligands, such as epidermal growth factor (EGF), transforming growth factor a, and amphiregulin, which bind only to EGFR; (2) a hydrophobic transmembrane domain that is involved in interactions between cell surface receptors; and (3) an intracellular domain that shows tyrosine kinase activity.
Results from gene expression profiles have shown that tumours that express high levels of the EGFR ligands epiregulin (EREG) and amphiregulin (AREG) are more likely to have disease control with cetuximab (EREG, P=0.