| Dictionary, Encyclopedia and Thesaurus - The Free Dictionary 3,897,058,434 visitors served. |
Dictionary/ thesaurus | Medical dictionary | Legal dictionary | Financial dictionary | Acronyms | Idioms | Encyclopedia | Wikipedia encyclopedia | ? |
Sporozoa |
Also found in: Dictionary/thesaurus, Medical, Wikipedia | 0.01 sec. |
|
|
Sporozoa (spôr'əzō`ə), phylum of unicellular heterotrophic organisms of the kingdom Protista Protista or Protoctista , in the five-kingdom system of classification, a kingdom comprising a variety of unicellular and some simple multinuclear and multicellular eukaryotic organisms.
..... Click the link for more information. . Unlike most other protozoans protozoan , informal term for the unicellular heterotrophs of the kingdom Protista. Protozoans comprise a large, diverse assortment of microscopic or near-microscopic organisms that live as single cells or in simple colonies and that show no differentiation into ..... Click the link for more information. , sporozoans have no cilia or flagella. All species are parasitic and have elaborate life cycles, often requiring more than one host. The best-known sporozoan is Plasmodium falciparum, the causative organism of malaria malaria, infectious parasitic disease that can be either acute or chronic and is frequently recurrent. Malaria is common in Africa, Central and South America, the Mediterranean countries, Asia, and many of the Pacific islands. ..... Click the link for more information. . Sporozoa [‚spȯr·ə′zō·ə] (invertebrate zoology) A subphylum of parasitic Protozoa, typically producing spores during the asexual stages of the life cycle. Sporozoa A subphylum of Protozoa, typically with spores. The spores are simple and have no polar filaments. There is a single type of nucleus. There are no cilia or flagella except for flagellated microgametes in some groups. In most Sporozoa there is an alternation of sexual and asexual stages in the life cycle. In the sexual stage, fertilization is by syngamy, that is, the union of male and female gametes. All Sporozoa are parasitic. The subphylum is divided into three classes—Telosporea, Toxoplasmea, and Haplosporea. See Haplosporea, Protozoa Sporozoa a class of parasitic protozoans including about 2,000 species. The class was identified in 1879 by the German scientist R. Leuckart. Sporozoans are characterized by primary alternation of generations and asexual and sexual reproduction. The principal stages in the life cycle are schizogony (asexual reproduction by multiple segmentation), gamogony (gamete formation and fertilization), and sporogony (formation of spores and sporozoites from the zygote). Schizogony is absent in most gregarines. Sporozoans parasitize the cells, tissues, and cavities of animals and humans. Schizogony leads to an increase in the number of parasites in the body of the host, and sporogony ensures infection of other individuals of the host species. Zygotic reduction is observed in all sporozoans: the first division of the zygote nucleus during sporogony is meiotic, and all the subsequent stages are haploid. Some sporozoans, for example, most coccidians, have a single host; their distribution is external and by means of oocysts, which are covered with protective sheaths. Other sporozoans, including Plasmodium (the causative agents of malaria), have two hosts: asexual reproduction occurs in one, and the sexual process and sporogony occur in the other. In these sporozoans transmission of the parasite from one host to the other is effected by a bite or by ingestion of the host by another animal. For example, malaria is transmitted to man by means of a mosquito bite, and Haemogregarina is transmitted when a lizard eats an infected tick. In such cases the stages with protective sheaths are absent, and tiny wormlike mononuclear cells—sporozoites—develop in sporocysts and infect the vertebrate host. Sporozoans include gregarines and Coccidiomorpha; the latter comprise Coccidia and Haemosporidia. Among the haemosporidians are the causative agents of a number of serious human disease (malaria, toxoplasmosis) and diseases of domestic mammals and birds (coccidiosis). REFERENCEZhizn zhivotnykh, vol. 1. Moscow, 1968. Pages 116–29.IU. I. POLIANSKII Want to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit the webmaster's page for free fun content. |
|
| Mentioned in | ? | References in periodicals archive | ? | Encyclopedia browser | ? | Full browser | ? | |||
|---|---|---|---|---|---|---|---|---|---|---|
No references found | It belongs to the subphylum Apicomplexa, class Sporozoa, and exists in nature in 3 forms: the oocyst (which releases sporozoites), the tissue cyst (which contains and may release bradyzoites), and the tachyzoite. Besides bolstering the theory that endosymbiotic events were common in evolutionary history, the finding may have medicinal value: The protozoans belong to the group Apicomplexa, which includes the organisms responsible for malaria and toxoplasmosis. EU1 Up GTTTCTGMCCCATCAGCTTGAC Down AGACAAGAGTCAATAACTCGATAAC CRYPTO Apicomplexa 65 F AACCTGGTTGATCCTGCCAGTAGTCAT R GAATGATCCTTCCGCAGGTTCACCTAC Primer Fragment Reference size, bp BAB 359 -11 GF2 GR2 EU1 362 -8 Up Down CRYPTO 1,727 -4 F R * For parasites from tick samples, no sequence could be obtained with primer set CRYPTO because such primers likely hybridize to the Nodes ricinus 18S rRNA gene and preferentially amplified this gene, probably because of its relative abundance. |
Apicomplexa |
APICC APICDA Apice apicectomy APICEM apices apices apices apices apices Apices juris non sunt jura APICH APICHA Apician apicitis Apicius Apicius International School of Hospitality Apicius, Marcus Gabius APICM APICNE APICO apico- Apicocomplexa apicoectomy APICOL Apicology Apicology apicolysis Apicomplex Apicomplexa Apicomplexa protozoaApicomplexan Apicomplexan Apicomplexia apicostomy apicostomy apicotomy APICS APICS APICS Business Outlook Index APICSA APICTA Apicular apiculate apiculate apicultural apicultural Apicultural Information and Issues Apicultural Science Association of China apiculture apiculture apiculturist apiculturist apiculturists apiculturists APID APIDA Apidae Apidae Apidae | |||||||
| Encyclopedia |
| Free Tools: |
For surfers:
Free toolbar & extensions |
Word of the Day |
Help
For webmasters: Free content | Linking | Lookup box | Double-click lookup |
|---|