Brucella

(redirected from Brucella canis)
Also found in: Dictionary, Thesaurus, Medical, Wikipedia.
Related to Brucella canis: Brucella suis, Brucella melitensis

Brucella

[brü′sel·ə]
(microbiology)
A genus of gram-negative, aerobic bacteria of uncertain affiliation; single, nonmotile coccobacilli or short rods, all of which are parasites and pathogens of mammals.
References in periodicals archive ?
9% (43/202) de anticuerpos contra Brucella canis en el distrito de Pucusana, Lima.
Descripcion de caracteristicas reproductivas en tres perros seropositivos a Brucella canis.
Yamada, "Purification of a Brucella canis cell wall antigen by using immunosorbent columns and use of the antigen in enzyme-linked immunosorbent assay for specific diagnosis of canine brucellosis," Journal of Clinical Microbiology, vol.
Watarai, "Detection of Brucella canis and Leptospira interrogans in canine semen by multiplex nested PCR," The Journal of Veterinary Medical Science, vol.
Aunque en este estudio se aislo una bacteria morfologicamente compatible con Brucela, en uno de los animales seropositivos, la morfologia y patron bioquimico no fueron consistentes con Brucella canis, hecho que se ve apoyado por los hallazgos histopatologicos.
Encuesta serologica sobre Brucella canis en pacientes atendidos en la clinica de pequenos animales de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional de Colombia.
2006), utilizando-se os oligonucleotideos B2N-1 (GTCGCGGATTCTACCTCACCT) e B2N-2 (TAAGCAGGTAAGAGGCAATTT) que amplificam um fragmento de 280 pares de bases(pb) do gene virB2 para a especie Brucella canis.
Biological properties and dog response to a variant (M-) strain of Brucella canis.
Multiplication of Brucella canis in male reproductive organs and detection of autoantibody to spermatozoa in canine brucellosis.
Zoonotic Species Preferential host potential Brucella melitensis Sheep, goat +++ Brucella abortus Cattle ++ Brucella suis Pig ++ Brucella canis Dog + Brucella ovis Sheep - Brucella neotomae Desert wood rat (Neotomae lepida) - Brucella ceti Cetaceans + Brucella pinnipedialis Seals + Brucella microti common voles (Microtus arvalis) -