CBD

Also found in: Dictionary, Medical, Financial, Acronyms, Wikipedia.

CBD

(Component Based Development) Building applications with components (objects). See component software.

Mentioned in ?

References in periodicals archive ?

PhytoSPHERE has done extensive research to identify specific genetic characteristics that make up these cultivars; the hemp is grown in special microclimates to allow for the highest concentration of CBD to come through in the plants.

CANCHEW EXPANDS INTO WHOLESALE DISTRIBUTION

CBD of HapS (1000 bp) was PCR-amplified using HindIII-tailed forward (TAAGAAGCTTCGCGTTCAGATTGGACAGG) and XhoI-tailed reverse (ATACTCGAGCAGGCTTTGATCAGGCAGG), primer pairs and through the application of the following thermal program.

Overexpression and purification of C-terminal fragment of the passenger domain of Hap protein from nontypeable Haemophilus influenzae in a highly optimized Escherichia coli expression system

CBD had earlier announced an issuance agreement with China UnionPay, signifying the introduction of the first CBD UnionPay Prepaid Card Payments programme in the GCC region.

CBD launches dual-currency debit card

Relocation of major companies from the CBD might cause a setback to the owners of office buildings in that district.

Development of office buildings in Jakarta

I perform it in patients I identify preoperatively as being at high risk for having a CBD stone based upon the presence of abnormal liver function tests, a dilated CBD upon ultrasound, and jaundice or pancreatitis.

Should intraoperative cholangiography be performed routinely during cholecystectomy?

Initial districts were chosen based on proximity to VCT centers (so clients could make the trip within a day), availability of CBD workers, and proximity to ZNFPC provincial offices for support and supervision.

Zimbabwe: 'I Have the knowledge and skills to help'

The CBD also requires that any company or country collecting natural products obtain the prior informed consent of the source country.

Who reaps the benefits of biodiversity? (Focus)

I was reading the CBD one day and the Army at 32 machines under Group 20.

MILLER ON PROCUREMENT

Agencies are required to announce all intended procurements of $25,000 or more, and, although these announcements appear in the CBD only once, potential suppliers have at least 30 days to respond.

How to contract with the U.S. government

CBD currently provides or has provided the decisioning backbone for companies as diverse as Citibank, Lack's Furniture, Mercedes-Benz of North America, Littman's Jewelers, and Verizon-where CBD's credit and collections scorecards facilitate every mobile and land-line credit and collections decision that Verizon makes today throughout the U.

GERS Partners with ApprovalWare to Deliver Integrated, Multimedia / Multi-Lender Credit Decisions; Demonstrations of latest software applications available at the Las Vegas Furniture Market, July 24-28, 2006

This launch will be initiated by the company's wholly-owned foreign enterprise CBD Biotechnology Co Ltd (CBD Biotech).

ChineseInvestors.com to unveil new luxury skincare line in China in February 2018

We promised to transform the Darwin CBD into a world-class tourist and cultural destination and thats exactly what were doing, Ms Moss said.