References in periodicals archive ?
Sequence Orientation Target AIKVf GGTGCCCTATTT AGGGTG AGG A Sense ABPV - IAPV - KBV ABPVr ACTACAGAAGGCAATGTCCAAGA Antisense ABPV IAPVr GGGAGTATTGCTTTCTTGTTGTG Antisense IAPV KBVr T GCACGGGAAGTATAAATAATTCT Antisense KBV DWVf TGGTCAATTACAAGCTACTT GG Sense DWV DWVr TAGTTGGACCAGTAGCACTCAT Antisense SBVf CGTAATTGCGGAGTGGAAAGATT Sense SBV SBVr AG ATTCCTTCGAGGGT ACCTCATC Antisense CBPVf AACCTGCCTCAACACAGGCAAC Sense CBPV CBPVr ACATCTCTTCTTCGGTGTCAGCC Antisense BQCVf CTTTATCGAGGAGGAGTTCGAGT Sense BQCV BQCVr GCAATAGATAAAGTGAGCCCTCC Antisense Amplicon length (bp) AIKVf ABPVr 460 IAPVr 158 KBVr 641 DWVf 269 DWVr SBVf 342 SBVr CBPVf 774 CBPVr BQCVf 536 BQCVr