Cyanine

(redirected from Cy5)
Also found in: Dictionary.

Cyanine

 

any one of numerous organic compounds containing two heterocyclic radicals connected by a chain consisting of an odd number of methine groups:

where Y and Y’ are O, S, Se, CR2, or some other element or radical, R and R’ are H or van alkyl, X is Cl, Br, I, or some other anion, and n = 0–5.

The general name for this class of compounds is derived from the first compound of the class, bright blue cyanin, or cyanine blue (from the Greek kyanos, “blue”). Depending on the number of methine groups in the chain, a distinction is made between simple cyanines (monomethines), in which n = 0, carbocyanines (trimethines), in which n = 1, dicarbocyanines (pentamethines), in which n = 2, and so forth. The basic method for the synthesis of cyanines involves the condensation of quaternary salts of heterocyclic compounds. Cyanines are polymethine dyes.

References in periodicals archive ?
The design of fluorescence-labeled samples (1) Gel-ID Label (2) Cy2 Cy3 Cy5 Gel 1 Interior label CH1 SH1 Gel 2 Interior label SH2 C1 Gel 3 Interior label C2 CH2 Gel 4 Interior label CH3 C3 Gel 5 Interior label SH3 CH2 (1) The regulation of labeled Is that sample of every group was not labeled only one kind fluorescence.
Equal amounts of protein extracts from each sample (total of 6) were pooled, and labeled with Cy2 as the internal standard, while Cy3 or Cy5 were used to label experimental or control samples (Table 1).
The probe for the internal control was labeled with Cy5 at the 5' end as the reporter dye and BHQ2 at the 3' end as the quencher; Cy5-5'-CTCGTAGTGAAAATTAATGGTGTTGAAC-3'BHQ2 (Eurofins, Germany).
5 [micro]M of each primer loaded with Cy5, about 10-100 ng of template DNA, 1 X Taq buffer and 1.
The primers were derived from HIV-1 strain HXB2 (outer primer bases 6953 to 6971, 5'-acagtacaatgtacacatgg-3', and bases 7749 to 7715, 5'ccactcttctctttgccttggtggg-3'; inner primer bases 7006 to 7025, 5'-/Cy5/aaatggcagtctagcagaag-3', and bases 7336 to 7317 5'/ Cy5.
Real-time nested amplifications of MY09/11 products were done by GP5+/GP6+ primers and Cyanine-5 labeled HPV 16 DNA specific probe [Primer F 5' TTTGTTACTGTGGTAGATACTAC 3', Primer R 5' GAAAAATAAACTGTAAATCATATTC 3', Cy5.
In cDNA, usually two individual heterogeneous mRNA samples are labelled with either a red-fluorescent dye Cy5 (referred as R) or a green fluorescent dye Cy3 (referred as G), respectively.
In the laboratory, each sample is labeled using red Cy5 and green Cy3 dyes.
Most microarray experiments employ the organic dyes, Cy5 and Cy3, or dyes with similar fluorescence spectra, for sample labeling, and most microarray scanner are configured for these dyes.
After isolation of mRNA using Trizol, mRNA from two sources (for example 4th generation 2,4-D and 4th generation control) was labeled with Cy5 and Cy3 using PCR and hybridized to a Drosophila microarray.
Protein micro-array: Antibodies spotted onto micro-array slides captured specific receptors on the parasite lysates, whereas the detection antibody coupled to the fluor Cy5 bound this complex thus providing a signal that was measured (Fig.