Gart


Also found in: Dictionary, Medical, Acronyms, Wikipedia.

Gart

 

(Ukrainian for “tempering”), the union of Ukrainian proletarian writers. Organized in 1923, Gart brought together prominent Ukrainian writers, including P. Tychina, V. Sosiura, I. Mikitenko, I. Kulik, and V. Blakitnyi. There was a theatrical Gart (a group of important figures in the workers’ theater), as well as a transoceanic Gart, whose members were Ukrainian proletarian writers of the USA and Canada, including I. Irchan, N. Tarnovskii, M. Shatul’skii, and V. Shopinskii. The mixed ideological and artistic aspirations of the union led to its collapse in 1925. In 1927 the All-Ukrainian Union of Proletarian Writers was founded. Its organ was Gart, a journal of literature and criticism, which was published from 1927 through 1932.

References in periodicals archive ?
In mismatch repair-proficient control blood samples, isSIR values for GART, AC1, TGFBRII, MSH3, and MSH6 microsatellite primer extension products representing one or two nucleotide deletions (-1/wt; -2/wt) were in the range of 0.
These included 4 alterations in GART (-1 and +1 frameshifts), 4 alterations in AC1 (-1 frameshift), 11 alterations in TGFBRII (-1, -2, and +1 frameshifts), 5 alterations in MSH3 (-1 and -2 frameshifts), and 7 alterations in MSH6 (+1 and +2 frameshifts).
Repeat Type Sequence (5'-3') GART X54199 A10 Sense AGTGTTGAAGAATGGCTCCCT Antisense TGTTCCCAGATATTAAGACAGCCAC AC1 D82070 T10 Sense TCACAAGACTCACAATTCAAAGAA Antisense TTTTGCGTGTTCCTTCCTTC TGFBRII D50683 A10 Sense CATGACCCCAAGCTCCCCTAC Antisense CATGAAGAAAGTCTCACCAGG MSH3 J04810 A8 Sense AAATGTGAATCCCCTAATCAAGC Antisense ACTTACCACAATGCCAATAAAAAT MSH6 U54777 C8 Sense GGGTGATGGTCCTATGTGTC Antisense CGTAATGCAAGGATGGCGTG PCR primers Gene Type Extension primer (5'-3') GART Sense [AGCCACTCTGGCC(T).