lac operon

(redirected from Lacz)
Also found in: Medical.

lac operon

[′lak ′äp·ə‚rän]
(genetics)
Three adjacent linked genes which code for the enzymes that act sequentially in lactose utilization in many bacteria.
Mentioned in ?
References in periodicals archive ?
15-17) As an early phase of the project, we tried to develop a whole mount in situ hybridization method that allowed detection of gene expression at a single-cell resolution and was applicable to many genetic backgrounds without crossing strains to transgenic reporter strains such as lacZ fusion-expressing transgenic animals.
2-kb hGFAP promoter drives expression of a LacZ reporter gene in mice in a manner similar to that of endogenous GFAP (Brenner et al.
The strong RBS recruits a ribosome to initiate translation at the start codon and translate a repressed LacZ enzyme to cause a color change.
Sequence data for lacZ mutants are archived in the NCBI sequence read archive under BioProject PRJNA342797.
The MCS of Blue script lies within the LacZ gene, which when expressed, in response to the presence of synthetic inducer IPTG and produces the enzyme b-galactosidase.
G207 has a LacZ reporter gene (from bacteria) inserted into the U 39 region to act as a disruption and allow detection by histochemical methods69.
TABLA I OLIGONUCLEOTIDOS USADOS EN ESTE ESTUDIO Especies bacterianas Secuencia 5'-3' Gen Streptococcus F: GCTTGTGTTCTGAGGGAAGC lacZ thermophilus R:CTTTCTTCTGCACCGTATCCA Lactobacillus F:GGAAGACTCCGTTTTGGTCA lacZ delbrueckii subsp.
White colonies were produced due to the insertion of CVMV-CP gene in multiple cloning sites of pTZ57R/T, which disrupts the expression of lacZ and these colonies were picked and maintained on LA medium containing ampicillin (100 ig/ml).
Effects of a lycopene-rich diet on spontaneous and benzo[a]pyrene-induced mutagenesis in prostate, colon and lungs of the lacZ mouse.
To confirm the effect of PTEN on NADPH oxidase/ROS, we infected replicative aged HDFs with adenovirus containing the PTEN gene (Ad/PTEN) or control lacZ (Ad/LacZ).
RNA Transfeccion Reovirus rinon de polimerasa hemorragico de carpa (CIK) (RdRp) Proteina carpa (GCR) de capside (OCP) Celulas de Proteina de Transfeccion Virus de rana ovarios de envoltura 53R grylio (RVG) carpa Celula u Resultado principal organismo Embriones de siRNAs suprimen efectivamente la trucha expresion transiente de GFP arcoiris localizado episomalmente, en un estado de desarrollo temprano y en embriones de truchas transgenicas Celulas Silenciamiento especifico del gen musculares reportero lacZ en celulas FHM por de expresion de shRNAs desde Pimephales plasmidos o por siRNAs promelas transfectados.
Bradley Cooper stars alongside Sienna Miller, Luke Grimes, Jake McDorman, Cory Hardrict, Kevin Lacz, Navid Negahban and Keir O'Donnell.