| Dictionary, Encyclopedia and Thesaurus - The Free Dictionary 1,824,132,319 visitors served. |
|
Dictionary/ thesaurus | Medical dictionary | Legal dictionary | Financial dictionary | Acronyms | Idioms | Encyclopedia | Wikipedia encyclopedia | ? |
phylum |
Also found in: Medical, Legal, Wikipedia, Hutchinson | 0.02 sec. |
|
phylum, in taxonomy: see classification taxonomy, the study of the relationships of organisms, which includes collection, preservation, and study of specimens, and analysis of data provided by various areas of biological research. ..... Click the link for more information. . phylum a major taxonomic division of living organisms that contain one or more classes. An example is the phylum Arthropoda (insects, crustaceans, arachnids, etc., and myriapods) phylum [′fī·ləm] (systematics) A major taxonomic category in classifying animals (and plants in some systems), composed of groups of related classes. How to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit webmaster's page for free fun content. |
|
| ? Mentioned in | ? References in periodicals archive | |
|---|---|---|
phagocyto- ge9f AACGGATTATTCTTTATAGCTTGCT philum (inner) ge2 GGCAGTATTAAAAGCAGCTCCAGG E. Results of PCR analysis and serum antibody titers to different tickborne pathogens tested at different times after the onset of illness * PCR ([dagger]) 16S RNA gene Days after Anaplasma ELISA IgM onset of phagocyto- Ehrlichia /IgG ([double illness philum chaffeensis dagger]) TBEV 12 Pos Neg 0. |
| Encyclopedia |
| Free Tools: |
For surfers:
Free toolbar & extensions |
Word of the Day |
Help
For webmasters: Free content | Linking | Lookup box | Double-click lookup | Partner with us |
|---|