R2000

Also found in: Wikipedia

0.01 sec.

R2000 - MIPS R2000

Want to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit the webmaster's page for free fun content.

?Page tools

Printer friendly
Cite / link

Feedback

Mentioned in	?		References in periodicals archive	?		Encyclopedia browser	?		Full browser	?
No references found			Its new R2000 neck-to-neck blow molding system is said to deliver nearly double the output of lightweight HDPE dairy bottles without increasing machine size. New machinery for blow molding by Knights, Mikell / Plastics Technology 0 R980 CTTGGAATGAGCAACAGAGA R2000 GTTAGGTCGTTCAATGAAGC 3/F1690-R2685 1. Genetic variability of West Nile virus in US blood donors, 2002-2005 by Grinev, Andriyan; Daniel, Sylvester; Stramer, Susan; Rossmann, Susan; Caglioti, Sally; Rios, Maria / Emerging Infectious Diseases He needs just over R2000 per year to finish his school. Ours is to inspire them by Pieters, Karolina / Sister Namibia			R-C coupled amplifier R-C coupling R-C network R-C oscillator r-combination R-DAT system r-permutation r-process r-RNA r-theta navigation R-UIM R-value R-Y R. B. Winter State Park R. U.R R.A. R/2 R/3 R/C R/L R/W R/W&L R:BASE R:BASE System RŠben-Chilbi R2000 R2RS R3.99RS R3RS R4RS Ra RA size Ra's al Unuf Ra's Gharib Ra-Shalom Raška Raab Raab, Julius Raabe's convergence test Raabe, Wilhelm Raahe Raamah Raamiah Raamses rab rab and dab Rab-saris Rab-shakeh Rába Rabab Rabadan Nurov			R/W R/W R/W R/W&L R/WM R:BASE R:BASE 2000 R:BASE System RŠben-Chilbi R0 R00L R00t R0x0r R0x0r R0x0rz R0x0rz R1 R1 Insertion from Bombyx Mori R1 space R1 topology R10 R10000 R18 R1Bm R1CU R2 R2 R2 R2-VADR R20-24 R2000 R216A R22 R22R R24 R254A R2A2 R2AC R2B R2C R2C2-S R2CP R2CSR R2D R2d2 R2DC3 R2E R2F R2FIR R2H R2I R2J R2K R2ML R2MS

Encyclopedia

Free Tools:	For surfers: Free toolbar & extensions \| Word of the Day \| Help For webmasters: Free content \| Linking \| Lookup box \| Double-click lookup

Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.