Encyclopedia

hypotenuse

Also found in: Dictionary, Medical, Acronyms, Wikipedia.
(redirected from HYP)

hypotenuse

the side in a right-angled triangle that is opposite the right angle
Collins Discovery Encyclopedia, 1st edition © HarperCollins Publishers 2005

hypotenuse

[hī′pät·ən‚üs]
(mathematics)
On a right triangle, the side opposite the right angle.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.

hypotenuse

(mathematics)
The side of a right-angled triangle opposite the right angle.
This article is provided by FOLDOC - Free Online Dictionary of Computing (foldoc.org)

hypotenuse

In a right triangle, the side opposite the right angle. See sine.
Copyright © 1981-2025 by The Computer Language Company Inc. All Rights reserved. THIS DEFINITION IS FOR PERSONAL USE ONLY. All other reproduction is strictly prohibited without permission from the publisher.
Mentioned in
References in periodicals archive
The physiological importance of Hyp O-arabinosylation in peptide hormones was further demonstrated by the discovery of the CLE-RS2 gene, which controls the number of root nodules to achieve balance in the symbiotic relationship between leguminous plants and rhizobia.
The estimated parameters of normal, HYP, GH, NIG, and VG distributions are presented in the Table 7.
Gene Accession number Sequences CTGF NM_010217 Forward: 5'AGCCAACTGCCTGGTCCAGA3' Reverse: 5'CGCAGAACTTAGCCCTGTATGT3' [alpha]-SMA BC064800 Forward: 5'TCCTTCGTGACTACTGCCGAGC3' Reverse: 5'AATGGTGATCACCTGCCCGTC3' iNOS BC062378 Forward: 5'ACTTCCAATGCAACATGGGAGC3' Reverse: 5'GTGGTGCGGCTGGACTTTTC3' FN BC145271 Forward: 5'TCTGGATACCGTGTGGAGGTCC3' Reverse: 'CTGACAGGCAGGACCTCCACA3' GAPDH NM_008084 Forward: 5'TGTGGATGGCCCCTCTGGAA3' Reverse: 'TTGGCAGGTTTCTCCAGGCG3' Table 2: Effect of Qingfei Xieding on lung coefficient, W-D, and HYP following bleomycin-induced lung fibrosis in rats.
Interestingly, as shown in Figures 6(a) and 6(b), GSK101 could significantly enhance the GAG and HYP syntheses in the hybrids in the FS group (p < 0.05).
The intrusions from each set were selected from self-report questionnaires assessing OCD-related intrusions (Garcia-Soriano, Belloch, Morillo, & Clark, 2011), BDD-related intrusions (Giraldo-O'Meara & Belloch, in press), hypochondriac (HYP) or illness and death-related intrusions (Arnaez, Garcia-Soriano, & Belloch, in press), and ED-related intrusions (Roncero et al., 2010).
The Hyp level is another indicator to show the degree of collagen deposition in fibrotic lung (Tanaka et al.
In a recent study (Kramer, Erbe, Bapst, Bieber, & Simianer, 2013) that considered each quarter as a distinct organ, range of heritability for Hyp was from 0.12 (for rear left teat) to 0.26 (front right) for Brown Swiss cows in Switzerland.
Subsequently, the NORM and HYP groups trained three times per week for 5 weeks in an environmental chamber, performing cycling repeat-sprint training at either sea-level (NORM) or 3000 m of simulated altitude (HYP).
Hydroxyproline (HYP) in liver homogenate was hydrolyzed with 12N HCl at 110C for 18 hours then oxidized into pyrrole followed by coupling with p-dimethyl-amino- benzaldehyde and the developed red color was measured spectrophotometrically at 456nm according to (Bergman and Loxley, 1963).
LBB and Berlin Hyp are currently undergoing a strategic realignment and
Copyright © 2003-2025 Farlex, Inc Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.