Encyclopedia

restriction site

Also found in: Dictionary, Medical, Financial, Wikipedia.

restriction site

[ri′strik·shən ‚sīt]
(cell and molecular biology)
A sequence in a deoxyribonucleic acid molecule that can be cleaved with a specific restriction endonuclease.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.
Mentioned in
References in periodicals archive
Nevertheless, the available variability of the fragment lengths is naturally very restricted due to (i) the limited distance between two restriction sites, and (ii) the usually very stringent size-selection step during library preparation.
Oligos Sequences Tm ([degrees]C) KpnLLexBpx_TEM GGTACCCTCTAWATATACACATGAGTATT 55 CAACATrrCCGTG KpnLpBR322 GGTACCACTCTTCCTnTTCAAT ATT ATT 50 pBR322_CS_seq AGCCTATGCCTACAGCATCCAG 62.1 In bold the restriction site for Kpnl, in italic the lexA box consensus sequence, underlined the [bla.sub.TEM-1] gene.
Numbers in parenthesis indicate the number of species within each family containing the correct restriction site. TABLE 2.
The "B" allele denotes absence of the Bsm1 restriction site, while "b" allele indicates presence of the restriction site.
Sequencing on a single lane of the flow cell yielded approximately 14 X [10.sup.6] paired-end reads, 97% of which were mapped to restriction sites with the predicted fragment length and used for subsequent analysis (see Table 1 in the online Data Supplement).
This SNP introduced a new SmaI restriction site into the Oka vaccine strain and provided the basis for developing a new PCR-RFLP technique for differentiation of wild-type VZV strains from the vaccine strain.
This study showed that the occurrence of a BsmI restriction site (denoted b) in the intron between exons 8 and 9 of the gene is associated with enhanced lumbar spine BMD.
This study independently applies morphological characters and a key based on mitochondrial restriction site variation to identify juvenile rockfishes collected in southern California during juvenile rockfish surveys.
The RNA transcript may be formed by linearization of the vector through cleavage at a unique restriction site in a plasmid vector and then transcribing the linear molecule.
Table 1 Binary character matrix consisting of 19 restriction sites. The presence of a restriction site is denoted by a "1", while "0" denotes the absence of the site.
Copyright © 2003-2025 Farlex, Inc Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.