Mentioned in

insertion site

References in periodicals archive

Primers with introduced restriction sites are also indicated.

Successful transcription but not translation or assembly of Solenopsis invicta virus 3 in a baculovirus-driven expression system

Nevertheless, the available variability of the fragment lengths is naturally very restricted due to (i) the limited distance between two restriction sites, and (ii) the usually very stringent size-selection step during library preparation.

Detection and removal of PCR duplicates in population genomic ddRAD studies by addition of a Degenerate Base Region (DBR) in sequencing adapters

Oligos Sequences Tm ([degrees]C) KpnLLexBpx_TEM GGTACCCTCTAWATATACACATGAGTATT 55 CAACATrrCCGTG KpnLpBR322 GGTACCACTCTTCCTnTTCAAT ATT ATT 50 pBR322_CS_seq AGCCTATGCCTACAGCATCCAG 62.1 In bold the restriction site for Kpnl, in italic the lexA box consensus sequence, underlined the [bla.sub.TEM-1] gene.

Curcumin inhibits the SOS response induced by levofloxacin in Escherichia coli

Numbers in parenthesis indicate the number of species within each family containing the correct restriction site. TABLE 2.

Investigation of epizootic shell disease in American lobsters (Homarus americanus) from Long Island Sound: I. Characterization of associated microbial communities

The "B" allele denotes absence of the Bsm1 restriction site, while "b" allele indicates presence of the restriction site.

Vitamin D receptor gene Bsm1 polymorphism positively correlates with prostate cancer

Sequencing on a single lane of the flow cell yielded approximately 14 X [10.sup.6] paired-end reads, 97% of which were mapped to restriction sites with the predicted fragment length and used for subsequent analysis (see Table 1 in the online Data Supplement).

Analysis of the size distributions of fetal and maternal cell-free DNA by paired-end sequencing

This SNP introduced a new SmaI restriction site into the Oka vaccine strain and provided the basis for developing a new PCR-RFLP technique for differentiation of wild-type VZV strains from the vaccine strain.

Differentiation of wild-type Varicella-zoster strains from India and the Oka vaccine strain using a VZV open reading frame--62 based PCR-RFLP technique

This study showed that the occurrence of a BsmI restriction site (denoted b) in the intron between exons 8 and 9 of the gene is associated with enhanced lumbar spine BMD.

The vitamin D receptor gene and osteoporosis

This study independently applies morphological characters and a key based on mitochondrial restriction site variation to identify juvenile rockfishes collected in southern California during juvenile rockfish surveys.

Comparing the identification of southern California juvenile rockfishes (genus Sebastes spp.) by restriction site analysis of the mitochondrial ND3/ND4 region and by morphological characteristics

The RNA transcript may be formed by linearization of the vector through cleavage at a unique restriction site in a plasmid vector and then transcribing the linear molecule.

Aventis Pasteur obtains United States patent

Table 1 Binary character matrix consisting of 19 restriction sites. The presence of a restriction site is denoted by a "1", while "0" denotes the absence of the site.

Mitochondrial DNA analysis of gene flow among six populations of collared lizards (Crotaphytus collaris) in West Central Texas

The lowland type has a restriction site change that is not present in upland type.

Meiotic Stability, Chloroplast DNA Polymorphisms, and Morphological Traits of Upland x Lowland Switchgrass Reciprocal Hybrids