consensus sequence


Also found in: Dictionary, Thesaurus, Medical, Legal, Wikipedia.

consensus sequence

[kən′sen·səs ‚sē·kwəns]
(genetics)
An average nucleotide sequence; each nucleotide is the most frequent at its position in the sequence.
Mentioned in ?
References in periodicals archive ?
Since the lexA box consensus sequence is only 16 bp, in order to clone it upstream the [bla.
CSIRO Entomology 120 Meiers Road Indooroopilly, Qld 4068, Australia) for providing the consensus sequences in the genetic divergence analysis.
Although a consensus sequence was found in case of PSA-C1 clones with high frequency, this corresponds only in two amino acid positions with PSA (amino acids 9-15), and two amino acids were of similar physicochemical characteristics (W vs Y).
The absence of congruence between the phylogenetic trees inferred from the 16S rRNA gene and the hsp65 and rpoB genes could be related to a short consensus sequence (369 bp) in a position that is not optimal for mycobacteria discrimination.
Then comparisons were made between the consensus sequence and the entries in the MicroSeq database.
The AP-1 reporter plasmids consist of firefly luciferase genes driven by an AP-1-responsive promoter containing four copies of flanked AP-1 consensus sequence (TCGACTATGATGAGTCATGGGGC) from GCN4 and a minimal albumin promoter region with TATA box:
More importantly, this version is a completely de novo assembly, whereas the previous versions by BGI and others used a reference-based assembly method to obtain a consensus sequence.
A possible explanation of the in-frame skipping of exon 2 and of the neighboring exon 3 is the complete removal of the consensus sequence of the 5' splice site of exon 2/intron 2 (13) and splicing alterations circumventing the nonsense codon in exon 3 of the cDNA so that translation terminates normally (14).
TABLE 8 GLOBAL CONSENSUS SEQUENCE & TRANSLATION PLATFORMS MARKET, BY GEOGRAPHY 2007-2014 ($MILLION)
Overall per-base accuracy was better than 99% and the accuracy of the consensus sequence was 100%.