desmin


Also found in: Dictionary, Medical, Acronyms, Wikipedia.
Related to desmin: Titin, vimentin

desmin

[′dez·mən]
(biochemistry)
The muscle protein forming the Z lines in striated muscle.
References in periodicals archive ?
List of primer sets for polymerase chain reaction analysis Gene Forward Reverse MyoD ATTGGCAATGAGAGGTTCAGG TAGAGCCTCCAATCCAGACAGA Myogenin AGCCTCAACCAGCAGGAGC TGCGCCAGCTCAGTTTTGGA Desmin CTGAAGGATGAGATGGCC GGTCGCCTCGCTCACCAC Gene Annealing temp.
Microscopically, cellular angiofibroma demonstrates short stubby nuclei, wispy collagen,numerous (hyalinized) vessels and is stained for CD34 +/-, desmin -/+, SMA -/+ and molecular identification is RB1 deletion.
23) Smooth muscle actin, desmin, DOG-1, bcl-2, [beta]-catenin, and ALK are negative.
To investigate damage to muscle tissue, Desmin as one of the effective factors in the contraction can be studied.
For exact typing of the nature of the lesion, immunohistochemistry was performed with the markers Pancytokeratin, Vimentin, Desmin and Smooth muscle actin.
The immunohistochemistry study was positive for vimentin, smooth muscle actin, and ALK-1 and negative for desmin, PS100, and CD34.
2), CK7, CK20, CDX-2, chromogranin, synaptophysin, TTF-1, desmin, smooth muscle actin, CD34, and HMB-45.
They may be differentiated from GIST by using immunohistochemistry and they are typically positive for a smooth muscle actin (SMA) and desmin and negative for c-kit, CD34 and DOG1.
14,15) Immunohistochemical markers, such as desmin and actin, can be used to differentiate renal leiomyoma from mesenchymal tumours.
Immunohistokimyasal olarak genellikle vimentin disindaki S100, CD34, duz kas aktini, desmin ve sitokeratin gibi belirleyicilerle negatif ya da dusuk oranda pozitiflik sergiledigi tespit edilmistir.