Insertion Elements

(redirected from insertion sequence)
Also found in: Dictionary, Medical, Acronyms, Wikipedia.
Related to insertion sequence: Inverted repeat, transposase

Insertion Elements

 

steel elements designed for joining built-up or cast built-up reinforced-concrete structures and products to each other or to other building structures or structural members. Insertion elements are manufactured from round, strip, sheet, angular, and channel steels. In most cases insertion elements consist of separate plates (flat elements) to which are welded straight or bent anchor rods (usually made of reinforced sectional batch steel) embedded in the concrete of the building or structures. The exposed surfaces of insertion elements are protected from corrosion by such methods as galvanizing.

References in periodicals archive ?
CTX-M] group 9 variants ISEcp1A (F) GCAGGTCTTTTTCTGCTCC Insertion sequence ISEcpl ISEcp1B (R) ATTTCCGGAGCACCGTTTGC Insertion sequence ISEcp1 B3A (F) AACGGCACAATGACGCTGGC Insertion sequence IS903 IS903 (R) TGTAATCCGGCAGCGTA Insertion sequence IS903 Pseudo (R) AACATTCGGCCGTTCACAGC Region downstream of [bla.
Insertion sequences may play major roles in the evolution of Tn4401, but little information is available about the bacterial strains and the plasmids that may explain this rapid spread.
Sensitivity of PCR targeting the IS2404 insertion sequence of Mycobacterium ulcerans in an assay using punch biopsy specimens for diagnosis of Buruli ulcer.
For most of the other deletions, 1 of the 2 highly abundant insertion sequence elements (IS2404 or IS2606) was situated in either the genomic sequences that flanked the deletion or that were in the deleted parts or in the substituting sequence stretches (as for deletion 3B).
Thus, the insertion sequences for these two Fraser Valley isolates are expected to be cleaved by furinlike proteases.
Virus from birds on the same source farm as A/Canada/504/04 showed insertion sequence match with HPAI H7N3, but IVPI was not performed (C.
The complete sequences of the infB gene H allele and the novel IS1563-like insertion sequence described in this article are available in the GenBank database under accession nos.
RFLP analysis using the IS6110 insertion sequence represents the standard criterion for differentiating M.
Specifically, insertion sequence interruption of the ompK36 porin gene in respiratory tract pathogen Klebsiella pneumoniae has been shown to interfere in the expression of this porin gene and has resulted in clinical failure (39).