pyrimidine


Also found in: Dictionary, Thesaurus, Medical, Wikipedia.

pyrimidine

(pīrĭm`ĭdēn'), type of organic base found in certain coenzymescoenzyme
, any one of a group of relatively small organic molecules required for the catalytic function of certain enzymes. A coenzyme may either be attached by covalent bonds to a particular enzyme or exist freely in solution, but in either case it participates intimately in
..... Click the link for more information.
 and in the nucleic acidsnucleic acid,
any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.
..... Click the link for more information.
 of plant and animal tissue. The three major pyrimidines of almost universal distribution in living systems are cytosinecytosine
, organic base of the pyrimidine family. It was isolated from the nucleic acid of calf thymus tissue in 1894. A suggested structure for cytosine, published in 1903, was confirmed in the same year when that base was synthesized in the laboratory.
..... Click the link for more information.
, thyminethymine
, organic base of the pyrimidine family. Thymine was the first pyrimidine to be purified from a natural source, having been isolated from calf thymus and beef spleen in 1893–4.
..... Click the link for more information.
, and uraciluracil
, organic base of the pyrimidine family. It was isolated from herring sperm and also produced in a laboratory in 1900–1901. When combined with the sugar ribose in a glycosidic linkage, uracil forms a derivative called uridine (a nucleoside), which in turn can be
..... Click the link for more information.
.

Pyrimidine

A heterocyclic organic

(2)
compound ( 1 ) containing nitrogen atoms at positions 1 and 3. Naturally occurring derivatives of the parent compound are of considerable biological importance as components of nucleic acids and coenzymes and, in addition, synthetic members of this group have found use as pharmaceuticals. See Coenzyme, Nucleic acid

Pyrimidine compounds which are found universally in living organisms include uracil ( 2 ), cytosine ( 3 ), and thymine

enlarge picture
(3)
( 4 ). Together with purines these substances make up the “bases” of nucleic acids, uracil and cytosine being found characteristically in ribonucleic acids, with thymine replacing uracil in deoxyribonucleic acids. A number of related pyrimidines also occur in lesser amounts in certain nucleic acids. Other pyrimidines of general natural occurrence are orotic acid and thiamine (vitamin B1). See Deoxyribonucleic acid (DNA), Purine, Ribonucleic acid (RNA)

Among the sulfa drugs, the pyrimidine derivatives, sulfadi-azine, sulfamerazine, and sulfamethazine, have general formula ( 5 ).

enlarge picture
(4)
These agents are inhibitors of folic acid biosynthesis in microorganisms. The barbiturates are pyrimidine derivatives which possess potent depressant action on the central nervous system.

Pyrimidine

 

(also called 1,3-diazine), a heterocyclic compound. Colorless crystals; melting point, 21°C; boiling point, 124°C. Pyrimidine is readily soluble in water, alcohol, and ether. The structural formula is

Pyrimidine is a very weak, monoacidic base that forms quaternary salts, each of which contains a single nitrogen atom; it also reacts with hydrogen peroxide (H2O2) to yield N-oxides. Pyrimidine does not enter readily into electrophilic substitution reactions, for example, halogenation, sulfonation, and nitration, but the hydrogen atom on the carbon in position number four is easily replaced in reactions with organomagnesium compounds, organolithium compounds, NaNH2, and KOH. Pyrimidine is synthesized by reduction of its 2,4,6-trichloro derivative, which is a product of the reaction of POCI3 with barbituric acid. Pyrimidine and its derivatives are components of individual nucleotides and of nucleic acids, the most important biopolymers. They also occur in many biologically active substances, including thiamine, the antibiotic, amicetin, and barbiturates.

pyrimidine

[pə′rim·ə‚dēn]
(biochemistry)
C4H4N2 A heterocyclic organic compound containing nitrogen atoms at positions 1 and 3; naturally occurring derivatives are components of nucleic acids and coenzymes.
References in periodicals archive ?
This intriguing finding leads to the hypothesis that the Polh gene, which encodes Pol [eta], evolved specifically to relieve replicative arrest associated with the presence of unexcised pyrimidine dimers in DNA following exposure of cells to UV radiation--and does so accurately.
A case of hemolytic anemia due to erythrocyte pyrimidine 5'-nucleotidase deficiency.
Effects of Acivicin and dichloroallyl lawsone upon pyrimidine biosynthesis in mouse L1210 leukemia cells.
Artificial and solar UV radiation induces strand breaks and cyclobutane pyrimidine dimers in Bacillus subtilis spore DNA.
PCR primer pairs used in this study * Primer Gene Genome name name Product name coordinates Orientation RdRp ORF 1b Nsp12-pp1ab 15146-15164 Sense primer (RdRp) 15213-15233 Antisense Nsp14 ORF 1b Nsp14-pp1ab 19113-19138 Sense primer (nuclease ExoN 19225-19249 Antisense homolog) Primer Product name length (bpSequence (5' to >3') RdRp 88 TAAGTTTTATGGCGGCTGG# primer TTTAGGATAGTCCCAACCCAT# Nsp14 137 TGTTTGTTTTGGAATTGTAATGTTGA# primer TGGAATGCATGCTTATTAACATACA# Note: 5' propynyl-modified pyrimidine nucleotides are shown in #.
Leflunomide is a pyrimidine synthesis inhibitor with a long half-life that blocks T cell clonal expansion.
It has been observed that patients with xeroderma pigmentosum show variably decreased repair of UV-induced pyrimidine dimmers and may show xerotic appearance of photoaging.
The vitamin appears to correct problems in pyrimidine metabolism, a compound important for the development of the spinal cord.
chloro-derivatives of purine and pyrimidine bases), and some compounds that have been proven to have carcinogenic properties (including trihalomethanes, the production of which is closely correlated with free chlorine residuals).
Tenders are invited for Lactones, neog, heterocyclic compounds only hetero-atom (s) of nitrogen with the structure noncondensable pirazynove ring, pyrimidine ring or ring piperazolne phenothiazine ring system not further condensation; hydantoin and its derivatives; sulphonamides
In other embodiments there is provided a platform for use, testing or detection (including diagnostic applications) of an antibody or small molecule (whether naturally occurring or artificial) or other biological molecule, for example, a protein, polypeptide, peptide, amino acid, or derivative thereof; a lipid, fatty acid or the like, or derivative thereof; a carbohydrate, saccharide or the like or derivative thereof, a nucleic acid, nucleotide, nucleoside, purine, pyrimidine or related molecule, or derivative thereof, or the like; or another biological molecule that is a constituent of a biological sample.