33965 AGAGTGCCTCTCTGTCCAGAAGTCAATCCA Rattus norvegicus AGAAGTGCTTAATGGGTTCCT submaxillary gland alpha-2[micro] globulin mRNA, complete cds /cds=158,603) /gb= J00738 /gi=204262 /[micro]g=Rn.

Quantitative PCR deconstruction of discrepancies between results ... by Rosenblum, I.Y. / Environmental Health Perspectives

16) Even so, Lewis et al found no hormonal concordance between salivary duct and breast carcinomas in their clinicopathologic and immunohistochemical review of 26 cases of salivary duct carcinoma that had arisen from the parotid and submaxillary glands.

Salivary duct carcinoma of the larynx: report of a rare case by Srivastava, Anand N. / Ear, Nose and Throat Journal

The variant also exhibited anti-proliferative (inhibition of cancer growth) and cytotoxic (cancer cell death) activity against human cancer cell lines such as submaxillary gland carcinoma and bladder carcinoma.

ALFACELL scientists report on characterization of a natural variant ... by Business Wire

More results

Encyclopedia browser

? Full browser

submarine trench
submarine trough
submarine valley
submarine wave recorder
submarine weathering
submarine well
submarining
submaxillary gland
submenu
submerged breakwater
submerged coastal plain
submerged culture
submerged fermentation
submerged lands
submerged screw log

Encyclopedia

Free Tools:	For surfers: Free toolbar & extensions \| Word of the Day \| Help For webmasters: Free content \| Linking \| Lookup box \| Double-click lookup \| Partner with us

All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional. Terms of Use.