Acorn Archimedes

(redirected from A3020)

Acorn Archimedes

References in periodicals archive ?
Evey Rose Staley, pictured, was fatally injured when the Subaru she was travelling in with her parents, Neal and Penny, collided with a Ford Puma on the A3020 Cowes Road in Newport, Isle of Wight, at about 8.
Initial variation among haplotypes was identified using A3772, A3661, and S2792 as sequencing primers; variable sites were then confirmed by sequencing the opposite strand using the primers S3506 and A3020 (Table 2, Appendix).
S2792 5[prime] ATACCTCGACGTTATTCAGA 3[prime] A3020 5[prime] ATCCATTCCACTAATCTGCC 3[prime] S3506 5[prime] ACTAGATGTAGA(C/T)AATCGAG 3[prime] A3661 5[prime] CCACAAATTTCTGAACATTGACCA 3[prime] A3772 5[prime] GAGACCATTACTTGCTTTCAGTCATCT 3[prime]