LPG

(redirected from APOE)
Also found in: Dictionary, Medical, Acronyms, Wikipedia.

LPG:

see liquefied petroleum gasliquefied petroleum gas
or LPG,
mixture of gases, chiefly propane and butane, produced commercially from petroleum and stored under pressure to keep it in a liquid state.
..... Click the link for more information.
.

LPG

liquified petroleum gas (LPG)

A petroleum derivative, primarily butane and propane, stored under pressure to maintain its liquid state; used as a fuel for heating and cooking.

LPG

1. Abbr. for liquid petroleum gas.

LPG

(1)
Linguaggio Procedure Grafiche (Italian for "Graphical Procedures Language"). dott. Gabriele Selmi. Roughly a cross between Fortran and APL, with graphical-oriented extensions and several peculiarities. Underlies the products of CAD.LAB Spa. "Graphical Procedure Language User's Guide and Reference Manual", CAD.LAB, Bologna, Italy, 1989, order code GO89/9.

LPG

(2)
Langage de Programmation Generique. An applicative language, both specification and functional. Special emphasis on parametrised declarations. "Design and Implementation of a Generic, Logic and Functional Programming Language", D. Bert et al, ESOP 86, LNCS 213, Springer 1986.
References in periodicals archive ?
Transformed data showed that serum APOE concentration was significantly lower in AMD patients compared to that in control subjects (p<0.
Two common variants in APOE gene 112 and 158 were amplified using forward primer 5'GGAACTGGAGGAACAACTGACC3' and 5'ACCTGCTCCTTCACCTCGTC3'.
Ya que el alelo E4 del gen APOE es un factor de riesgo de diversos trastornos claramentemente demostrado, es importante saber que impacto tiene en la incidencia poblacional de estos.
Interestingly, only one subjective memory symptom at baseline was needed to accurately predict verbal memory decline over time among APOE epsilon-4 carriers, compared with three or more needed to predict decline in noncarriers.
Scientists cannot fully explain the neural mechanisms underlying the effect of hypertension and APOE e4 on amyloid accumulation.
The amount of explosives each APOE may hold at one time is limited to a total known as the "net explosive weight" (NEW).
However, epidemiological studies indicate that the presence of the APOE [epsilon]4 allele cannot explain the overall heritability of AD, implying that a significant proportion of the LOAD cases are attributable to additional genetic risk factors.
Further sequencing of the APOE gene demonstrated various mutations, such as apoE Sendai, which was found in multiple Japanese patients and showed an autosomal-recessive mode of transmission.
Abbreviations: AD = Alzheimer disease, APOE [epsilon]4 = apolipoprotein epsilon 4, BiPAP = bilevel positive airway pressure, CI = confidence interval, CPAP = continuous positive airway pressure, CSA = central sleep apnea, MCI = mild cognitive impairment, MinSaO2 = minimum level of arterial oxygen saturation, NFT = neurofibrillary tangle, OR = odds ratio, OSA = obstructive sleep apnea, RDI = Respiratory Disturbance Index, SDB = sleep disordered breathing, SNP = single nucleotide polymorphism, TBI = traumatic brain injury, VA = Department of Veterans Affairs.
There are three common human protein isoforms of apoE (apoE, protein; APOE, gene) which differ by single amino acid interchanges at residues 112 and 158: E3 ([Cys.
In recent years, as the military has increasingly relied on commercial sourcing and shippers, its role in APOE frustration levels has become even more of an issue for the Air Force.