Tango

(redirected from ARNT)
Also found in: Dictionary, Thesaurus, Medical, Acronyms.

tango

1. a Latin American dance in duple time, characterized by long gliding steps and sudden pauses
2. a piece of music composed for or in the rhythm of this dance

Tango

 

a modern ballroom dance of Argentinian origin. The tango is in duple time and has the same rhythmic form as the habanera. One of the most popular ballroom dances of America and Europe, it is also performed on the stage. The tango rhythm is used in both instrumental and vocal music. The dance is usually included in ballroom dancing courses.

Tango

(1) An augmented reality platform. See Google Tango.

(2) A phone and video calling application over Wi-Fi or cellular for Windows PCs, Windows Phone, iPhone and Android from TangoME, Inc., Palo Alto, CA (www.tango.me). Callers can record a video message if the recipient does not answer. Tango competes with the hugely popular Skype and FaceTime video calling services.

(3) The code name for a minor update to Version 7.5 of Windows Phone. See Windows Phone.
References in periodicals archive ?
James Arnt Aune, "Witchcraft as Symbolic Action in Early Modern Europe and America," Rhetoric & Public Affairs 6, 4 (Winter 2003): 765-777.
James Arnt Aune, "Three Justices in Search of Historical Truth: Romance and Tragedy in Establishment Clause Jurisprudence," Rhetoric & Public Affairs 2, 4 (Winter 1999): 573-589.
James Arnt Aune, "Tales of the Text: Originalism, Theism, and the History of the U.S.
James Arnt Aune, "The Work of Rhetoric in the Age of Digital Dissemination," Quarterly Journal of Speech 83, 2, (May 1997 : 230-242.
James Arnt Aune, "On the rhetorical Criticism of Judge Posner," Hastings Constitutional Law Quarterly 23, 3 (Spring 1996): 658-669.
James Arnt Aune, "Karl Marx on 'The Gettysburg Address,'" Iowa Journal of Communication 25 (Fall 1993): 107-109.
James Arnt Aune, "Burke's Palimpsest: Rereading Permanence and Change," Communication Studies 42 (1991): 234-237.
James Arnt Aune, "Marxism and Rhetorical Theory," Communication 11 (1990): 265-276.
James Arnt Aune, "Lincoln and the American Sublime," Communication Reports 1 (Winter 1988): 14-19; reprinted in James R.
James Arnt Aune, "Burke's Late Blooming: Trope, Defense, and Rhetoric," Quarterly Journal of Speech 69 (August 1983): 328-340.
Name Primer Sequence (5'-3') AHR Forward gtgcttcatatgtcgtctaag Reverse aatgagttcacatcctgaggc Oligonucleotide actgaagcagagctgcagagaccactaacag ARNT Forward cggaacaagatgacagcctac Reverse acagaaagccatctgctgcc Oligonucleotide ggtacccacctgtagggcagtttctcacatg CYP1B1 Forward gtgatgccctggctgcag Reverse aatcgagctggatcaaagttc Oligonucleotide cggccactatcactggaattggatcaggtc IL-1 [beta] Forward gcatccagctacgaatctcc Reverse ccatatcctgtccctggag Oligonucleotide gcatccagctacgaatctccggacaagctgaggaa [beta]-ACT Forward gtgcgtgacattaaggagaag Reverse gaaggtagtttcgtggatgc Oligonucleotide gagaagagctacgagcgctgccctgaggcac RT-PCR product, bp AHR 915, sample 714, IS ARNT 520, sample 430, IS CYP1B1 608, sample 510, IS IL-1 [beta] 318, sample 265, IS [beta]-ACT 213, sample 171, IS