
Also found in: Dictionary, Wikipedia.
Related to Ajanta: Ellora


(əjŭn`tə), village, Maharashtra state, W central India, in the Ajanta Hills. The famous Ajanta caves, discovered in 1819, contain remarkable examples of Buddhist art. The caves, carved out of the side of a steep ravine, consist of chapels and monasteries dating from c.200 B.C.–A.D. 650 with magnificent frescoes and sculpture depicting scenes from the life of Buddha.
The Columbia Electronic Encyclopedia™ Copyright © 2013, Columbia University Press. Licensed from Columbia University Press. All rights reserved. www.cc.columbia.edu/cu/cup/
References in periodicals archive ?
PM Narendra Modi with Tushar Patni, Managing Director, Ajanta Jewellers
Cash deposits were made in various proprietory concerns, which ultimately reached Ajanta Merchants in the form of share capital and premium.
Dr Ajanta presented 'Lasers in Dermatology' and explained about Laser basics, development, physics and application in dermatology treatments and beauty therapy.
Another key player was Rana Day, who went from being a bus conductor to opening The Ajanta (1963), with subsequent businesses including Anapurna and Omar Khayum.
Nineteen wheat genotypes (Sonara 64, K 9351, HP 1633, Raj 4037, Sharbati Sonara, K 9533, K 8434, NP 823, Ajanta, PBW 12, KRL, RW 346, HD 2643, HS 1097, NP 825, PBW 226, NIAW 301, PBW 343, and NI 179) were selected on the basis of low disease severity under field conditions for molecular validation of stripe rust resistance gene Yr18 by using allele-specific markers Cssfr2 (F=TTGATGAAACCAGTTTTTTTTCTA R=TATGCCATTTAACATAATCATGAA).
The most striking example of relatively smaller companies scaling up in the US is Ajanta Pharma(Rs1,744 crore).
In this volume, they are particularly concerned with the previously unexplored connections between Bagh and Ajanta, and with the surprising manner in which the Vakataka caitya halls at Ajanta were wrenched around in the rock in a remarkable attempt to shift them into alignment with the solstices, even after their excavation had been started.
Delhi's high court has suspended its order restraining Ajanta Pharma (NSE:AJANTPHARM) from manufacturing and selling overseas an erectile dysfunction medicine in which German pharma company Bayer (ETR:BAYN) has a patent, DNA India reported on Sunday.
2 -- Ajanta Pharma Limited, announces today US FDA* approval and launch of Amlodipine + Olmesartan Medoxomil Tablets in the US market through its wholly owned subsidiary Ajanta Pharma USA Inc.
-- Ajanta Pharma is a specialty pharmaceutical company that develops, manufactures and markets high-quality generic drugs that target a variety of therapeutic needs.
It's, therefore, wise that when the Deccan Odyssey, a luxury train that travels through Maharashtra and Rajasthan, Gujarat and Goa, not always on one single journey, embarked on its maiden voyage for the year to Ajanta and Ellora caves, the state government's MTDC handed the controls over to a more experienced partner in the luxury segment: Cox & Kings.
EVER SINCE THE WORK OF JAMES FERGUSSON IN THE 1840S, SCHOLARS OF Ajanta have recognized that there were actually two quite distinct phases of work at the caves, separated by as much as 600 years--the same gap as I separates the Lodhi Garden tombs from the modern tower blocks of Gurgaon.