BGP

(redirected from BGLAP)
Also found in: Dictionary, Medical, Acronyms.
Related to BGLAP: osteopontin, Osteonectin

BGP

BGP

(1) See also BPG.

(2) (Border Gateway Protocol) The routing protocol that is used to span independent networks on the Internet (see autonomous system). BGP is a robust, sophisticated and scalable protocol that was developed by the Internet Engineering Task Force (IETF). It supports the CIDR addressing scheme, which increased the number of available IP addresses on the Internet. BGP is a path vector protocol that superseded EGP, the original gateway protocol. See EGP, CIDR and routing protocol.
References in periodicals archive ?
No differences regarding the gene expression of BGLAP (osteocalcin) and RUNX (cbfa1) between the groups were observed (Figures 6(e) and 6(f)).
Gene Description Primer [T.sub.m] GAPDH Glyceraldehyde Forward: 5' TCGGTGTGAACGG 55.[degrees]C 3-phosphate ATTTGG 3' Dehydrogenase Reverse: 5' TCTCCACTTTGCC 57.4[degrees]C ACTGCA 3' BGLAP Osteocalcin Forward: 5' CTGACAAAGCCTT 55.2[degrees]C CATGTCCAA 3' Reverse: 5' GCCGGAGTCTGTT 58.3[degrees]C CACTACCTT 3' RunX Transcription Forward: 5' CTTCAAGGTT 58.4[degrees]C factor RunX2 GTAGCCCTCGGA 3' Reverse: 5' ATGACGGTAACCA 58.5[degrees]C CAGTCCA 3' AP Alkaline Forward: 5' AAGGATATCGAC 54.1[degrees]C phosphatase GTGATCATGG 3' Reverse: 5' GGCCTTCTCAT 56.7[degrees]C CCAGTTCGTA 3' Smad4 SMAD family Forward: 5' CACAAGTCAGC 59.4[degrees]C member 4 CGGCCAGTATT 3' Reverse: 5' TTCCAGTCCAG 59.0[degrees]C GTGGTAGT 3'
The mRNA expression level of RUNX2 (P = 0.0028), SPP1 (P [less than or equal to] 0.001), and BGLAP (P = 0.011) was also upregulated after 21 days of incubation in osteogenic medium (Figure 4(c)).
Gene Sense Antisense Gapdh GTATGACTCCACTCACGGCAAA GGTCTCGCTCCTGGAAGATG Adiponectin GCTCAGGATGCTACTGTTGCAA AACGTCATCTTCGGCATGACT Cebpa CGCAAGAGCCGAGATAAAGC CGGTCATTGTCACTGGTCAACT Pparyl GGTGAACCACTGATATTCAGGACA TGTGTCAACCATGGTAATTTCAGT Ppary2 TGAGCACTTCACAAGAAATTACC TGCGAGTGGTCTTCCATCAC Runx2 GACTGTGGTTACCGTCATGGC ACTTGGTTTTTCATAACAGCGGA Bglap GGCCCTGAGTCTGACAAAGC GCTCGTCACAAGCAGGGTTAA Spp1 CCCATCTCAGAAGCAGAATCTCC TTCATCCGAGTCCACAGAATCC Ibsp CCACACCCCAAGCACAGACT CTTTCTGCATCTCCAGCCTTCT Sp7 GGTCCAGGCAACACACCTAC GGTAGGGAGCTGGGTTAAGG Alp GCTCTCCGAGATGGTGGA AGCCTGCTTGGCCTTACC Table 2: Summary of studies describing isolate methods and in vitro culture conditions for mouse BM-MSCs.
Expression of osteogenic markers ALP and BGLAP (bone gamma-carboxyglutamate protein) showed a significant increase in BMP6-treated cells (Figures 1(h) and 1(i)).
The cells were then analyzed for gene expression of osteogenic associated markers (BMP2, osteocalcin, COL1A1, and RUNX2), which were found to be significantly upregulated in the iOP population with only BGLAP found to be significantly different as compared between the iOP and hMSC population (Figure 4(d)).
Bone gamma carboxyglutamate protein (Bglap) and bone morphogenetic protein 2 (Bmp2) are expressed in D1 cells and not in mAo cells.