okra

(redirected from Bamia)
Also found in: Dictionary, Thesaurus.

okra:

see mallowmallow,
common name for members of the Malvaceae, a family of herbs and shrubs distributed over most of the world and especially abundant in the American tropics. Tropical species sometimes grow as small trees.
..... Click the link for more information.
.
The Columbia Electronic Encyclopedia™ Copyright © 2013, Columbia University Press. Licensed from Columbia University Press. All rights reserved. www.cc.columbia.edu/cu/cup/
Enlarge picture
okra

okra

Also called Ochro, Okoro, Quimgombo, Quingumbo, Ladies Fingers and Gumbo. Hibiscus-like flowers and seed pods that are delicious when picked young and tender. Eat raw, steamed of cooked.. Ripe seeds have been used as a substitute for coffee and can be dried and powdered for storage. In Mallow family so its very mucilaginous, meaning it emits a slimy goo when cooked. Very good for you, high in fiber, unsaturated fats, oleic and linoleic acids.
Edible Plant Guide © 2012 Markus Rothkranz
The following article is from The Great Soviet Encyclopedia (1979). It might be outdated or ideologically biased.

Okra

 

(Hibiscus esculentus), an annual plant of the mallow family. Height to 1.5 m; it is similar to the cotton plant in its outward appearance and flowers. It is native to East Africa. The unripe, podlike fruits are used for food as vegetables, rough fibers are extracted from the stalks, and a coffee substitute is prepared from the seeds. It is cultivated in tropical and subtropical countries, North America, and southern Europe. In the USSR it is grown in the Transcaucasian region.

REFERENCE

Berliand, S. S. “K agrobiologicheskomu izucheniiu bamii.” In Lubianye kul’tury. Moscow, 1950.
The Great Soviet Encyclopedia, 3rd Edition (1970-1979). © 2010 The Gale Group, Inc. All rights reserved.

okra

[′ō·krə]
(botany)
Hibiscus esculentus. A tall annual plant grown for its edible immature pods. Also known as gumbo.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.

okra

1. an annual malvaceous plant, Hibiscus esculentus, of the Old World tropics, with yellow-and-red flowers and edible oblong sticky green pods
2. the pod of this plant, eaten in soups, stews, etc.
Collins Discovery Encyclopedia, 1st edition © HarperCollins Publishers 2005
References in periodicals archive ?
For cooking Bamia Mix cooking oil with a glass of water and 1-2 spoons of sugar, and bring to a boil.
The salads were followed by a heaping tray of tomato, cabbage, zucchini, peppers and eggplant mahshi as well as wara einab, rice, bamia (okra in tomato sauce), and betingan makdoos (spiced, pickled eggplant).
The Ramadan menu includes an enticing selection of main courses to choose from such as Fatteh Bil Lahmeh & Mahashi, Fatteh Bil Hummous & Kharoof Mahshi, Vermicelli Rice & Hamri Bel Forn, Fatteh Bil Hummous & Samak Sayadiah, Vermicelli Rice & Mulokhia, Fatteh Bil Lahmeh & Kibbeh Bil Laban, Fatteh Bil Hummous & Samak Bil Forn, Fatteh Bil Lahmeh & Roasted Lamb Cutlets, Vermicelli Rice & Djaj Belforn, Vermicelli Rice & Bamia, Fatteh Bil Hummous & Dajaj Mahshi, Fatteh Bil Lahmeh & Kosa Bil Laban, Fatteh Bil Lahmeh & Kosa Bil Laban, Fatteh Bil Hummous and Samak Meshwe, Fatteh Bil Hummous & Samak Meshwe and more.
[6.] Yiannakopoulou E, Damianou C, Bamia C, Papdopulos JS.
One of the photographs shows a boat captioned HMT Bamia Castillo while another shows a sports team from the Rifle Brigade with the Kailana Sports Cup dated June 2, 1923.
The Image, the Icon, and the Covenant, trans, by Aida Bamia. Interlink, 2007.
Seguidamente, el producto de la digestion fue ligado con un adaptador/primer diferente para cada poblacion de ADNc (Poblacion 1: BamIa, ATGAAGTGCACCCTACGATTCGAG; BamIb, pGATCCTCGAAATCGTA GGGGTGCACT.
The ultrastructure of the spermatozoa has been described in many bivalve genera, such as Bamia candida (Pasteels & Harven 1962), Hyriopsis schlegelii (Higashi 1964), Turtonia minuta (Ockelmann 1964), Mytilus edulis and M.
The menu offers Mediterranean dishes alongside African specialities so you can choose between dishes such as a Greek salad at pounds 3.50 or bamia which is spicy okra cooked slowly with lamb or chicken at pounds 7.50.
Indeed, Rivers provides a flavour of Jewish life in Baghdad and beyond--literally so, with a panel specially devoted to the history and recipes of familiar dishes, like mahasha, (stuffed peppers), kubba bamia, (lamb and okra stew), or arook tahin bel samak, (fish cakes).
I'm not exactly sure where the Egyptian part begins or ends but The Pyramids' lunch buffet has plenty of familiar items: Hommos, Falafel, Tabouleh, Greek Salad with Pita, Bamia (okra stew), Potato Salad, Shawerma (beef and lamb), Shawerma Chicken, and, believe it or not, French Fries.
A la rupture du jeUu[beaucoup plus grand que]ne, les Iraniens commencent par lae1/4aoeau chaude, sucreries, gUuAoteaux notamment la zolbia (lae1/4aoUu[c]quivalent de la chebbakia), bamia et rotab sans oublier les rafraUuAchissements.