CBD


Also found in: Dictionary, Medical, Financial, Acronyms, Wikipedia.

CBD

CBD

(Component Based Development) Building applications with components (objects). See component software.
References in periodicals archive ?
PhytoSPHERE has done extensive research to identify specific genetic characteristics that make up these cultivars; the hemp is grown in special microclimates to allow for the highest concentration of CBD to come through in the plants.
CBD of HapS (1000 bp) was PCR-amplified using HindIII-tailed forward (TAAGAAGCTTCGCGTTCAGATTGGACAGG) and XhoI-tailed reverse (ATACTCGAGCAGGCTTTGATCAGGCAGG), primer pairs and through the application of the following thermal program.
CBD had earlier announced an issuance agreement with China UnionPay, signifying the introduction of the first CBD UnionPay Prepaid Card Payments programme in the GCC region.
Relocation of major companies from the CBD might cause a setback to the owners of office buildings in that district.
I perform it in patients I identify preoperatively as being at high risk for having a CBD stone based upon the presence of abnormal liver function tests, a dilated CBD upon ultrasound, and jaundice or pancreatitis.
Initial districts were chosen based on proximity to VCT centers (so clients could make the trip within a day), availability of CBD workers, and proximity to ZNFPC provincial offices for support and supervision.
The CBD also requires that any company or country collecting natural products obtain the prior informed consent of the source country.
I was reading the CBD one day and the Army at 32 machines under Group 20.
Agencies are required to announce all intended procurements of $25,000 or more, and, although these announcements appear in the CBD only once, potential suppliers have at least 30 days to respond.
CBD currently provides or has provided the decisioning backbone for companies as diverse as Citibank, Lack's Furniture, Mercedes-Benz of North America, Littman's Jewelers, and Verizon-where CBD's credit and collections scorecards facilitate every mobile and land-line credit and collections decision that Verizon makes today throughout the U.
This launch will be initiated by the company's wholly-owned foreign enterprise CBD Biotechnology Co Ltd (CBD Biotech).
We promised to transform the Darwin CBD into a world-class tourist and cultural destination and thats exactly what were doing, Ms Moss said.