coup

(redirected from COWP)
Also found in: Dictionary, Thesaurus, Medical, Acronyms.

coup

(ko͞o) [Fr.,=blow], among Native North Americans of the Plains culture, a war honor, awarded for striking an enemy in such a way that it was considered an extreme act of bravery. Generally, coups were awarded according to the degree of difficulty and danger involved; the most extreme, such as striking an armed enemy with the bare hand, counted highest. Killing an enemy, wounding him, scalping him, or stealing his horse or gun—all these were coups of value. Recital of the deeds was an important social function, and a warrior with many coups held a high status and was honored at feasts, ceremonials, and in the tribe. After warfare had ceased, coups became transferable property, passing from the old men to the younger, who needed coups to acquire warrior status in the tribe.

coup (d'état)

the sudden overthrow of state power by unconstitutional, usually violent, means. In contrast to a revolutionary change in power, in a coup there may be no intention to change the social and economic set-up radically. Instead, a change in the governing group may be all that is intended. In recent decades, many coups have been military (see MILITARY INTERVENTION IN POLITICS). See also REVOLUTION.
References in periodicals archive ?
La sensibilidad de los iniciadores utilizados en la presente investigacion, disenados sobre el ADN ribosomal, el gen COWP y el gen Hsp70, mostraron tener niveles similares de sensibilidad para detectar parasitos del genero Cryptosporidium.
8R TGTAAATTACTGCTATTTGCGTTGA UC26F GCGAGTGAACAGGAAAAAGC rDNA UC26R CGAGCTTCCACCAGACTTTC HSPF3 GCTGSTGATACTCACTTGGGTGG Hsp70 HSPR3 CTCTTGTCCATACCAGCATCC HSPF4 GGTGGTGGTACTTTTGATGTATC HSPR4 GCCTGAACCTTTGGAATACG CRY-9 GGACTGAAATACAGGCATTATCTTG COWP CRY-15 GTAGATAATGGAAGAGATTGTG BCOWPF ACCGCTTCTCAACAACCATCTTGTCCTC BCOWPR CGCACCTGTTCCCACTCAATGTAAACCC Producto Producto iniciador obtenido esperado Autor (Pb) (Pb) CPB-DIAGF 430 420-450 Johnson CPB-DIAGR et al.
specimens) Mixed Participant COWP DHFR infection 0043D -- -- No 0214D -- -- No 0448D C.
PCR products were purified by using QIAquick spin columns (Qiagen, Mississauga, ON) according to the manufacturer's instructions before digestion with the restriction endonucleases Mse I (New England BioLabs, Mississauga, ON) for the ITS 1 locus and Rsa I (New England BioLabs) for the COWP gene.
PCR products from the variable 18S rRNA and COWP gene loci were cleaned by spin column purification using the QIAquick PCR Purification kits (Qiagen).
In 218 sporadic human cases, DNA could not be amplified from 9% of samples for genotyping by PCR-RFLP analysis of the COWP gene (5,8), despite amplification of 18S rDNA fragments or detection of oocysts by microscopy.