choline acetyltransferase

(redirected from Choline Acetyl Transferase)
Also found in: Medical.

choline acetyltransferase

[¦kō‚lēn ə‚sed·əl′tranz·fə‚rās]
(biochemistry)
An enzyme that transfers the acetyl group to choline in the synthesis of acetylcholine from acetyl coenzyme A and choline.
Mentioned in ?
References in periodicals archive ?
Presynaptic cholinergic function, such as loss of choline acetyl transferase (ChAT), the enzyme for synthesis of acetylcholine (ACh) from choline and acetyl-coenzyme A, and the vesicular acetylcholine transporter (VAChT), the transporter for the accumulation of acetylcholine (ACh) inside the synaptic vesicles, is changed in AD [26,27].
Table 1: Primer names and sequences used for qRT-PCR Genes Forward primer Reverse primer P-actin AAGATCAAGATCATTGCTCCTC CTCAGTAACAGTCCGCCT ACE TTGACGTGAGCAACTTCC CAGATCAGGCTCCAGTG ChAT TCATTAATTTCCGCCGTCTC AGTCCCGGTTGGTGGAGTC qRT-PCR: Quantitative real-time polymerase chain reaction, ACE: Angiotensin converting enzyme, ChAT: Choline acetyl transferase
The clinical features of Alzheimer's disease have been associated with cholinergic dysfunction due to reduction of the activity of the enzyme choline acetyl transferase. This dysfunction is caused by the excitatory amino acids glutamate or aspartate, which, in turn, provoke excessive production of nitric oxide (NO) inflammatory molecules.