DPP

(redirected from DSPP)
Also found in: Dictionary, Medical, Legal, Acronyms.
References in periodicals archive ?
Regarding the odontoblast markers, the DSPP transcripts increased by 5-fold in the OLC-7 cells and 25-fold in the OLC-21 cells compared with hDPSC.
In the current research, the Foxc2 gene-modified SCAP upregulated the expression of osteo-/odontogenic markers, including ALP, OCN, DSPP, and DMP1.
Phenotypic Classification of Dentinogenesis Imperfecta Type Clinical Manifestations Involved Gene(s) I Osteogenesis imperfecta with opalescent teeth COL1A1, COL1A2 II Opalescent dentin DSPP III Shell teeth, affects Brandywine isolate DSPP Table 5.
Gene Primers DSPP Forward: 5' AATGCTGGAGCCACAAAC 3' Reverse: 5' GCTTCCTTAGTCCCATTTC 3' ALP Forward: 5' GAGCAGGAACAGAACTTTCC 3' Reverse: 5' GTTCCAGCCTCTGGAGAGTA 3' OCN Forward: 5' CAAAGGTGCAGCCTTTCTGTC 3' Reverse: 5' TCACAGTCCGGATTGAGCTCA 3' BMP-2 Forward: 5' GCCACCCGAGCCAACAC 3' Reverse: 5' MATTAAAGAATCTCCGGGTTGT 3' FCF2 Forward: 5' CCCGACGGCCGAGTTGAC 3' Reverse: 5' TTCATAGCCAGGTAACGGTTAGC 3' CAPDH Forward: 5' AGTCCACTGGCGTCTTCA 3' Reverse: 5' CGGACTTCTCATGGTTCACAC 3' Determination the gene expression of bone morphogenetic protein-2 (BMP-2) and fibroblast growth factor 2 (FGF2)
In 1992, he and fellow members of the Securities Transfer Association wrote two standard plans--a bank-sponsored DSPP and a company-sponsored DSPP--both of which the SEC adopted as "pre-approved models" at year-end in 1994.
You can participate in direct stock purchase plans (DSPPs), or dividend reinvestment plans (DRIPs).
Metformin significantly increased the mRNA expression of odontoblastic gene markers, including DSPP, DMP-1, Runx2, and OCN mRNA (Figure 5).
Actualmente se conoce que su etiologia esta relacionada con una alteracion del gen DSPP (codificacion establecida para identificar las sialoproteinas y fosfoproteinas de la dentina humana) localizado en el cromosoma 4q21, asi como el gen Cbfa1 (con el que se codifica el factor activador de los odontoblastos) ubicado en el cromosoma 6p21.
The expression levels of alkaline phosphatase (ALP), bone sialophosphoprotein (BSP), osteopontin (OPN), dentin sialophosphoprotein (DSPP), and dentin matrix protein (DMP-1) were significantly increased in cells cultured after 10 days without addition of materials in comparison to those in actively growing cells after 3 days of culture (Figure 2(b), bars 1 and 2 in A-E), suggesting that hDPSCs could be differentiated into osteo/odontoblasts by themselves under the prolonged culture condition.
Oil & gas company Zion Oil & Gas Inc (NasdaqGM:ZN) reported on Monday the extension of the expiration date for the unit programme under its Dividend Reinvestment and Common Stock Purchase Plan (DSPP).
On day 28, the expression of hard tissue-forming markers including DSPP, BSP, and four integrins that were upregulated by Npnt on day five was assessed (Figure 7).
Zions recent $250 Unit Program under its Dividend Reinvestment and Common Stock Purchase Plan (DSPP), ended successfully on July 12, 2017.