delete

(redirected from Deletions)
Also found in: Dictionary, Thesaurus, Medical.
Related to Deletions: duplications

delete

(operating system)
(Or "erase") To make a file inaccessible.

Usually this operation only deletes information from the tables the file system uses to locate named files; the file's contents still exist on disk and can sometimes be recovered by scanning the whole disk for strings which are known to have been in the file. Files created subsequently on the same disk are quite likely to reuse the same blocks and thus overwrite the deleted file's data permanently.

delete

(character)
The control character with ASCII code 127. Usually entering this character from the keyboard deletes the last character typed from the input buffer. Sadly there is great confusion between operating systems and keyboard manufacturers as to whether this function should be assigned to the delete or backspace key/character.

The choice of code 127 (binary 1111111) is not arbitrary but dates back to the use of paper tape for input. The delete key rewound the tape by one character and punched out all seven holes, thus obliterating whatever character was there before. The tape reading software ignored any delete characters in the input.
This article is provided by FOLDOC - Free Online Dictionary of Computing (foldoc.org)

delete

To remove an item of data from a file or to remove a file from the disk. See Delete key, Del, file wipe, trash and undelete.
Copyright © 1981-2019 by The Computer Language Company Inc. All Rights reserved. THIS DEFINITION IS FOR PERSONAL USE ONLY. All other reproduction is strictly prohibited without permission from the publisher.
References in periodicals archive ?
The [alpha]-thal-2 ([alpha]+) deletions are the most common form of AT defects, with two major forms, -[alpha]3.7 and -[alpha] 4.2 prevalent throughout the world.
"Even though during the last Vidhan Sabha election also such deletion has taken place and the same was reported to the Commission, the Election Commission has not taken any stringent action against such officials.
Genotype Analysis: Multiplex PCR assay was used to screen out homozygous deletions in GSTM1 and GSTT1 genes.15 The sense and antisense primers used in the reaction were 5' GAACTCCCTGAAAAGCTAAAGC 3' and 5' GTTGGGCTCAAATATACGGTGG 3' for GSTM1, 5' TTCCTTACTGGTCCTCACATCTC 3' and 5' TCACCGGATCATGGCCAGCA 3' for GSTT1 which resulted in 219bp and 459bp fragments respectively.
Multiplex ligation-dependent probe amplification (MLPA) has proved to be a reliable tool for the diagnosis of genetic diseases.[11] MLPA has been introduced and is now widely used to detect both deletions and duplications of the dystrophin gene.
Rarely, BWS has been caused by the deletion of a small amount of DNA from the maternally inherited copy of the IC2 region.
In the genetic study, we identified a deletion of 7.23 Mb in the 7p13-p12.1 region (genomic coordinates Chr7: 42807167 to 50040279).
To better understand how these deletions and duplications affected the brains of autism patients, the researchers performed MRI brain scans on 79 patients who had the genetic deletion associated with autism, and 79 individuals with the duplication.
Also, for common [alpha]-globin gene cluster deletions (-[alpha]3.7, -[alpha]4.2,--MED and -[alpha]20.5), multiplex Gap-PCR based on Liu et al.'s study was performed (21).
When the distance between two deletions is less than 2% of the shorter deletion length, they are considered as duplications.
If insertion of a name could be added to the ballots then there is no reason why a deletion of name could not be similarly undertaken, especially when such deletion would affect only one province, he said
The deletions were detected through separation of the PCR products by electrophoresis on a 1.5% agarose gel (stained with ethidium bromide).