References in periodicals archive ?
The primer pair (Lep forward, GGCTTACTGCTGTGTGGTCT and rreverse, AATGGCCACGGTTCTACCTC) amplifying the 461 bp DNA fragment (containing the exon 2 and part of the intron 1 and intron 2) was designed using the Primer 3 (NCBI) program (accession AY495587).
Three different mutations were observed in exon 22 and two in each of exons 1, 4, 6, 13,14, 23, 35, and 44 and introns 29 and 40; however, no accumulation in a specific exon was observed.
Amplification of fragments containing intron 20 of OGT by PCR revealed a variation between the European and Chinese pig breeds.
Mager, "Distributions of transposable elements reveal hazardous zones in mammalian introns," PLOS Computational Biology, vol.
By sequencing all the four products in all 221 patients (FET, FPD, and ET-PD) and 100 controls, no exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected.
Then the lariat is joined by spliceosome and the introns are removed to form a circRNA.
Average Shannon entropy for each genomic feature [exon, intron, or untranslated region (UTR)] of HLA-A, HLA-B, and HLA-C was calculated by dividing the sum of Shannon entropy over the feature divided by the total length of the genomic feature.
In the study, Fire, Frokjaer-Jensen and colleagues engineered a gene for a fluorescent jellyfish protein with an intron containing PATC watermarks.
The [[beta].sub.2]M, a 6 kb gene (357 bp cds), located on 10th chromosome of bovine, is conserved across species, including mammals and birds containing four exons and three introns. It is located outside of the MHC region.
It is well established that introns results in increased stability and expression of genes (Buchman and Berg, 1988; Okkema et al., 1993).
Molecular analysis identified a novel splice site mutation in DFNA5 intron 8 (IVS8+1 delG).
Moreover, a relevant biological effect can be linked to nucleotide alteration located in introns (Chorev and Carmel, 2012).