Also found in: Acronyms, Wikipedia.


Kernel Language 1.

An experimental AND-parallel version of KL0 for the ICOT project in Japan. KL1 is an implementation of FGHC.

Not to be confused with KL-ONE.

["Design of the Kernel Language for the Parallel Inference Machine", U. Kazunori et al, Computer J (Dec 1990)].
References in periodicals archive ?
Figure 1 shows an example of informative STR marker applied to the paternal and maternal blood DNA, to the DNA of the born baby and to large KL1 positive cells identified in the maternal blood.
"I am very proud that we have been able to develop and release our newest table top counter, the KL1 and our KL60 robot in the last 18 months.
Correlation matrices of QRST integral map coefficients (Only the first 6 KL coefficient correlations of the patients shown in Figure 1 are presented) KL1 KL2 KL3 KL4 KL5 KL6 KL1 1.00 0.27 -0.07 -0.35 0.14 -0.23 KL2 0.27 1.00 -0.76 0.10 0.59 -0.72 KL3 -0.07 -0.76 1.00 -0.06 -0.48 0.69 KL4 -0.35 0.10 -0.06 1.00 -0.25 -0.23 KL5 0.14 0.59 -0.48 -0.25 1.00 -0.28 KL6 -0.23 -0.72 0.69 -0.23 -0.28 1.00 KL1 KL2 KL3 KL4 KL5 KL6 KL1 1.00 0.27 0.22 0.02 0.10 0.12 KL2 0.27 1.00 -0.03 0.21 0.49 0.13 KL3 0.22 -0.03 1.00 0.25 0.00 0.07 KL4 0.02 0.21 0.25 1.00 -0.18 0.06 KL5 0.10 0.49 0.00 -0.18 1.00 -0.02 KL6 0.12 0.13 0.07 0.06 -0.02 1.00
1994] is an efficient portable implementation of the concurrent logic language KL1 (Kernel Language 1) for distributed and shared-memory machines.
GHC, defined in 1984, has proved to be a sound basis for KL1, the kernel language used for the development of PIMOS, the PIM operating system, and the PIM applications.
Other broad-spectrum CKs containing keratin 8 and keratin 18, such as the clones KL1, OSCAR, MAK6, and 5D3/LP3, are also popular choices as screening CKs.
Canoeing is making its debut at the XV Paralympics in Rio and The 46-year-old from Berkshire, a fivetime Paralympian as a swimmer and gold medallist at Atlanta 1996, won the women's KL1 event.
The KL1 (5'TCCGGAGCGAGTTACGAAGA3') and KL2 (3,AATCAATGCCCGGGATTGGT5') primers were used to amplify a 241 bp fragment of the C.
We wanted to develop a fifth-generation kernel language--what we now call KL1. The diagram includes these hopes of ours.
Now 46, she turned to canoeing while teaching swimming and enjoyed instant success, capped by KL1 victory here.