Leaf Curl


Also found in: Wikipedia.

leaf curl

[′lēf ′kərl]
(plant pathology)
A fungus or viral disease of plants marked by the curling of leaves.

Leaf Curl

 

a widespread disease of plants, marked by the formation of protruding sections of the tissues of the leaves. These thickenings cause the leaves to curl, twist, and become wavy. The causative agents of leaf curl are fungi of the order Exoascales (leaf curl of peach, the Amygdalus, cherry, pear, black alder, Acer tatarica, birch, and poplar) and viruses (leaf curl of tobacco, cotton, sugarbeet, strawberry, potato, raspberry, and hop). Leaf curl is sometimes caused by insects, such as aphids (leaf curl of black, red, and white currants), or by mites.

The sources of the infectious principle in fungous leaf curl include the endogenous mycelium in branches and shoots and ascospores that have wintered under the glumes of buds and in cracks in the bark. The causative agents of viral leaf curl are transmitted during the vegetative reproduction of the plant and are spread by sucking insects (leafhoppers, aphids, and thrips) and mites.

Control measures include pruning and burning severely affected shoots; culling out sick plants (this method is used with plants that have viral leaf curl); early-spring spraying of fruit trees with fungicides; destroying weeds (reservoirs of viral infections), insects, and mites; and cultivating varieties that are resistant to leaf curl.

References in classic literature ?
To-day as I went by, whistling, I saw a leaf curled and knew there must be something inside it.
The spokesman said growers must carry out pest scouting of recommended poisons with an interval of 15 days as it would help reduce the impact of leaf curl virus.
Spokesman said the growers must carry out pest scouting of recommended poisons with an interval of 15 days as this would help in reducing the impact of leaf curl virus.
The Punjab Agriculture Department in a statement in Oct 2017 had also said the ban on import of tomatoes would help in eliminating various diseases that had been spreading in crops as the Indian tomatoes were infected with five diseases and viruses such as leaf curl New Delhi virus, yellow leaf curl virus, aspermy virus and mosaic virus.
| PEACHES and apricots grown against a fence or wall can be given some protection against peach leaf curl by erecting a rain shelter made of plastic.
Ministry of Agriculture ordered on Oct.14 to stop tomato seed imports after the infection of thousands of acres with yellow leaf curl virus (TYLCV) was confirmed.
FAISALABAD -- In a bid to counter pest attacks, the Plant Protection and Research Institute, the Guangdong Academy of Agriculture Sciences China, the University of Agriculture Faisalabad (UAF) and Muhammad Nawaz Sharif University of Agriculture Multan (MNSUA) will carry out joint research, especially on cotton leaf curl virus (CLCV) and whitefly.
It has been observed that cotton crop is susceptible to attack of Cotton Leaf Curl Virus (CLCV) this year due to climatic change.
LAHORE -- It has been observed that cotton crop is susceptible to attack of Cotton Leaf Curl Virus (CLCV) this year due to climatic change.
The most destructive disease of which is the tomato leaf curl disease, which is transmitted by whiteflies.
Aftab Qamar in the subject of Molecular Biology after approval of her thesis entitled 'Search of Cotton Leaf Curl Virus Tolerant Gene (S) by Differential Display'.
DNA extract was allowed for PCR based detection of virus using primers (TLCVAV1-F 5'CGAACCGACCAGCAGATATCA 3' and TLCVAV1-R 5'TTTGATGCAT GAGTACAGGCCA 3') from the CP region of leaf curl virus (Singh et al., 2013).