Nucleoprotein


Also found in: Dictionary, Thesaurus, Medical, Acronyms, Wikipedia.

Nucleoprotein

A generic term for any member of a large class of proteins associated with nucleic acid molecules. Nucleoprotein complexes occur in all living cells and in viruses, where they play vital roles in reproduction and protein synthesis.

Classification of the nucleoproteins depends primarily upon the type of nucleic acid involved—deoxyribonucleic acid (DNA) or ribonucleic acid (RNA)—and on the biological function of the complex. Deoxyribonucleoproteins (complexes of DNA and proteins) constitute the genetic material of all organisms and of many viruses. They function as the chemical basis of heredity and are the primary means of its expression and control. Most of the mass of chromosomes is made up of DNA and proteins whose structural and enzymatic activities are required for the proper assembly and expression of the genetic information encoded in the molecular structure of the nucleic acid. See Deoxyribonucleic acid (DNA)

Ribonucleoproteins (complexes of RNA and proteins) occur in all cells as part of the machinery for protein synthesis. This complex operation requires the participation of messenger RNAs (mRNAs), amino acyl transfer RNAs (tRNAs), and ribosomal RNAs (rRNAs), each of which interacts with specific proteins to form functional complexes called polysomes, on which the synthesis of new proteins occurs. See Ribonucleic acid (RNA)

In simpler life forms, such as viruses which infect animal and plant cells and bacteriophages which infect bacteria, most of the mass of the viral particle is due to its nucleoprotein content. The material responsible for the hereditary continuity of the virus may be DNA or RNA, depending on the type of virus, and it is usually enveloped by one or more proteins which protect the nucleic acid and facilitate infections. See Bacteriophage, Chromosome, Nucleic acid, Virus

A typical human diploid nucleus contains 5.6 × 10-12 g of DNA. This DNA is arranged in 23 pairs of chromosomes differing in size and DNA content. The large number 1 chromosome, for example, contains 0.235 × 10-12 g of DNA, while the much smaller chromosome number 22 contains only 0.046 × 10-12 g. The DNA double-helix of chromosome 1 is actually 7.3 cm long, but this thin filamentous molecule is packaged to form a chromosome less than 10 micrometers long. The enormity of the packing problem can be appreciated from the fact that the average human contains about 100 g of DNA, and 0.5 g would reach from the Earth to the Sun! The reduction in size is largely due to interactions between the DNA and sets of small basic proteins called histones. All somatic cells of higher organisms contain five major histone classes, all of which are characterized by a high content of basic (positively charged) amino acids.

Nucleoprotein

 

a complex consisting of a nucleic acid and a protein. Nucleoproteins are widespread in nature. Deoxyribonucleoproteins and ribonucleoproteins are distinguished according to the nucleic-acid component. Deoxyribonucleoproteins constitute the chromatin matter in the nucleus of all cells and are present in the bodies of spermatozoa. Basic proteins called histones are the main protein component of deoxyribonucleoproteins. Smaller basic proteins called protamines occur in the spermatozooa of some animals, mainly birds and fish. Histones and protamines at neutral pH carry a large positive charge, which ensures a strong electrostatic interaction with nucleic acids, which are negatively charged. Deoxyribonucleoproteins are believed to be distributed in the grooves of the double helix of deoxyribonucleic acid, where they stabilize the helical structure and regulate the matrix activity of DNA. Many viruses, informosomes, and ribosomes consist of ribonucleoproteins (seeINFORMOSOMES).

REFERENCES

Finean, J. Biologicheskie ul’trastructury. Moscow, 1970. (Translated from English.)
Khimiia biologicheski aktivnykh prirodnykh soedinenii. Moscow, 1970.

I. B. ZBARSKII

nucleoprotein

[¦nü·klē·ō′prō‚tēn]
(biochemistry)
Any member of a class of conjugated proteins in which molecules of nucleic acid are closely associated with molecules of protein.
References in periodicals archive ?
Detection of canine distemper virus nucleoprotein RNA by reverse transcription-PCR using serum, whole blood, and cerebrospinal fluid from dogs with distemper.
Like the flu virus's evolving nucleoprotein, the ancestral receptor's structure had to be buttressed before it could withstand the mutations that would make the receptor choosier.
The region involved in nucleoprotein receptor (NR) binding is localized within the hyper variable N- terminal region of Measles virus (MeV) N.
An ELISA for detection of antibodies against influenza A nucleoprotein in humans and various animal species.
Following cDNA synthesis using RevertAid first Strand Synthesis Kit (Fermentas, EU), the portion of nucleoprotein coding genome region of rabies RNA was amplified using forward primer (5'TTGT(AG)GA(TC)CAATATGAGTACAA3') and reverse primer (5'CCGGCTCAAACATTCTTCTTA3') described by Davis (1998) with minor modification.
The absence of fast green staining in sperm after DNA extraction by TCA and their retention of a high concentration of arginine reaction products suggests that a conversion from a primarily histone type of basic nucleoprotein to a more arginine-rich, protamine-like protein accompanies spermiogenesis in these spiders.
In a sense, the chromosome contains two intertwined types of information: the linear sequence of nucleotide bases in DNA codes for biologic macromolecules, and the regulatory information embedded in the nucleoprotein architecture of chromatin specifies which regions of the genome are active in any given cell.
The fact that chromosomes are also nucleoproteins (containing DNA) makes it seem that viruses are chromosomes "on the loose" and that it is nucleoprotein that is the essence of life.
Table I shows the levels of ACTH release from dispersed pituitary cells of young (2-4 months) and mature (16-18 months) rats, after incubation with hypothalamic secretagogues, nucleoproteins or peptide MB35.
Structural disorder within the nucleoproteins and phosphoproteins of measles, Nipah and Hendra viruses
The polymerase basic (PB) 1 and 2, polymerase acidic, and nonstructural genes of Q1 and Q39 were all of Yangtze River Delta lineage A, and nucleoprotein genes were of Yangtze River Delta lineage B.
The RAD51 recombinase plays a central role in HR, forming nucleoprotein filaments at sites of DNA damage and promoting homologous pairing and DNA strand exchange.