RLF


Also found in: Dictionary, Medical, Acronyms, Wikipedia.

RLF

Reuse Library Framework of the DoD.
Mentioned in ?
References in periodicals archive ?
The money was raised during a special drinks reception to celebrate property and construction consultancy Robinson Low Francis's (RLF) 50th anniversary in the city.
RLFs specifically supply funding for loans and sub-grants to carry out cleanup activities at brownfield sites.
The RLF North Midlands Championship is contested annually by the three Domestic Union - Greater Birmingham, Shropshire and Worcestershire & Herefordshire - that make up the North Midlands RFU.
Catherine Connan at Armadillo, added: "RLF has a long and successful association with Birmingham in a number of high-profile clients including the University of Birmingham, Stoford Developments, Aston University and Aston Science Park.
The RLF submission to provide quantity surveying services was led by Paul Anderson, partner at RLF in Birmingham, who heads up the practice's education division.
The dual luciferase reporter gene primer sequence of RLF: 5'CCGCTCGAGTAGAAACAGACTGGCTCCAACAC 3' 5'GAATGCGGCCGCATCAATAAACCAACTGGAGAGCTAA 3'
Priyanka Joshi, the owner of Kiddie Time Educational Child Care, received a $30,000 RLF loan and created 20 new jobs when she opened her new 6,000-square-foot childcare facility in Marlborough in April 2017.
These sites are in addition to fourteen conditionally acquired Sites identified in the prospectus as being acquired from TIO RLF and a site at Ballyboughal, County Dublin also identified in that document.
HO failure is most commonly caused by a radio link failure (RLF), and can be classified into late HO failure, early HO failure, and wrong cell HO failure [8].
For most of his 32-year career, he's focused solely on healthcare design, working in a variety of roles, including as assistant director of facilities at Monmouth Medical Center (Long Branch, N.J.); private sector leader, healthcare at RLF Architects (Orlando, Fla.); and most recently as director of healthcare services at Gannett Fleming (South Plainfield, N.J.).