restriction site

(redirected from Restriction sites)
Also found in: Dictionary, Thesaurus, Medical, Wikipedia.
Related to Restriction sites: Restriction digest

restriction site

[ri′strik·shən ‚sīt]
(cell and molecular biology)
A sequence in a deoxyribonucleic acid molecule that can be cleaved with a specific restriction endonuclease.
Mentioned in ?
References in periodicals archive ?
For each fragment, specific primers with appropriate restriction sites were designed and used.
Evaluation of a novel method based on amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) for typing strains of vancomycin-resistant Enterococcus faecium.
Primers used for amplification of lipase gene with additional of NdeI and SalI restriction sites No Primer Nucleotide sequence(5'[right arrow]3') 1 Feksp CAACATATGAACAAGAACAAAACCTTGCTCGCC 33 2 Resksp AAAGTCGACGAGCCCCGCGTTCTT 24 No Primer [SIGMA] basa Tm ([degrees]C) 1 Feksp 61 2 Resksp 60
In order to clone the fragment containing the [beta]-globin gene promoter in a pBluescript II SK (pSK) vector, [beta]_KpnI and [beta]_XhoI primers, engineered to contain both KpnI and XhoI restriction site, respectively, were used.
Locations of the restriction sites (black hash marks), bacterial transposon Tn7 sites (grey triangles), polyhedrin promoter (angled arrow corresponding to the sequence below), SINV-3 open reading frames (dark closed arrows), and approximate location of the area detected by the polyclonal antibody preparation (pAb) are shown.
Therefore, longer fragments affected by ADO could be misinterpreted as alleles without a mutation in the restriction site. This problem can be avoided with ddRAD, for which two restriction enzymes are utilized (Davey et al., 2013).
Oligonucleotides used to amplify CLCuKoV promoter were P1 (5' GTTGACTAAAATTGAATCACC-3') as forward with the addition of SacI restriction site and P2 (5'- CAAACGCATACTTAGCAACG-3') as reverse primer with the addition of SalI restriction site.
Faloona et al., "Enzymatic amplification of [beta]-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia," Science, vol.
(5) Restriction sites introduced to forward and reverse primers for amplifying VH are chosen based on restriction sites of pFUSEss-CHIg-hG1 in the 5' to 3' direction, including EcoRI, EcoRV, XhoI, and NheI.
The RsaI peak at 400 bp matched the restriction site in several [gamma]-proteobacteria, including that of 37 Vibrio species, as well as several more species from Firmicutes and [alpha]-proteobacteria.
The purified 186-bp DNA fragment corresponding to the first huIFN[alpha]2 synthetic fragment was cloned into pGX4T1/rhuIFN[alpha]2a (wild type cDNA sequence) previously cut at the 5' EcoRI and 3' BglII restriction sites to generate a plasmid containing only the 48 bp corresponding to the 16 residues at the huIFN[alpha]2 COOH terminus.
For the alignment of A DNA digest, the first 2 cycles on both ends were omitted because they corresponded to the restriction site sequences and because the domination of certain bases in the first cycle caused calibration problems in the image analysis software.