SP5


Also found in: Medical, Acronyms.

SP5

(Service Pack 5) The fifth service pack introduced to upgrade a major release of software. See service pack.
References in periodicals archive ?
For each file, of each group of experiments (P3, P4, P5, SP3, SP4 and SP5), adaptability and stability analysis of LIN & BINNS (1988) was performed.
During the study period, the higher contents of HC[O.sub.3.sup.-] and [Ca.sup.2+] were registered in SP4 piezometer, whereas the optimal concentrations of S[O.sub.4.sup.2-] were measured in SP5 piezometer, which is located in the east of the PG storage.
The suspension was then transferred to the confocal camera, and microphotographs were obtained with a Leica TCS SP5 MP microscope ([[lambda].sub.ex] = 488 nm, [[lambda].sub.ex] = 510 - 560 nm, dry objective x40).
The coverslips containing the immunolabelled cells were observed under a confocal Leica TCS SP5 microscope (Leica Microsystems) equipped with a HeNe/Ar laser source for fluorescence measurements and with differential interference contrast (DIC) optics.
Colloidal solutions of AF647-Zol-loaded NVs and DNVs in (d) and (e), respectively, were imaged by confocal laser microscopy using a Leica TCS SP5 microscope following dialysis, lyophilization, and resuspension.
Machon et al., "Wnt-mediated downregulation of Sp1 target genes by a transcriptional repressor Sp5," Journal of Biological Chemistry, vol.
Genotype PCR primer sequences (5; [right arrow] 3;) S1647T TF: TGACAGTGAAAGTGGAAGGTTG (T>A) K1637K TR: Biotin-CCTATTGGCAAAGCAATCTGGA (A>G) UGT1A1*2$ GF: Biotin-CCCTGCTACCTTTGTGGACT [A(TA)6TAA>A(TA)7TAA] UGT1A1*6 GR: CATTATGCCCGAGACTAACAAA (G>A) Genotype Typing primer sequences Typing primer (5; [right arrow] 3;) applications S1647T SP1: AAATTTCCAAAGAACTACATG Genotyping (T>A) K1637K SP2: TGTGGAAAAATTTCTTTCAAA Genotyping; (A>G) haplotyping * SP3: TGTGGAAAAATTTCTTTCAAAG Haplotyping" UGT1A1*2$ SP4: GGTTCGCCCTCTCCTACTTA Genotyping [A(TA)6TAA>A(TA)7TAA] SP5: GTCTTCAAGGTGTAAAATGCTC Genotyping; UGT1A1*6 haplotyping * (G>A) SP6: GTCTTCAAGGTGTAAAATGCTCC Haplotyping" SP7: GTCTTCAAGGTGTAAAATGCTCT Haplotyping" The SNP sites associated with typing primers were as follows.
Stained cell membranes were visualized with a 40 X 1.2 NA objective on a SP5 laser-scanning confocal microscope (Leica Microsystems) with 488 and 561-nm excitation and detections windows at 500-550 nm (green) and 570-650 nm (red).
Family flowers only, donations in lieu of floral tributes may be made directly to Help For Heroes, Unit 14, Parkers Close, Downton Business Centre, Downton, Salisbury, Wiltshire, SP5 3 RB.
Aos 42 dias apos a inoculacao (DAI), o isolado SP5 ja apresentava 100% de plantas sintomaticas, e aos 72 dias todas as plantas inoculadas ja estavam mortas (Tabela 5).
As a control group, the bacterial suspension without cinnamon oil was also observed (Leica TCS SP5) (Wang et al., 2010).
The viability and fluorescence of ESCs-loaded GMs were assessed and imaged using a Leica two-photon fluorescence confocal imaging TCS SP5 System (Leica Microsystems, Mannheim, Germany) from day 1 to day 7 in vitro .