SRY


Also found in: Dictionary, Medical, Acronyms, Wikipedia.

SRY

[¦es¦är′wī]
(genetics)
The male sex-determining gene on the Y chromosome in mammals.
References in periodicals archive ?
The probe hybridization showed two signals for CEPX (Green) at the centromeric region of both the X chromosome and one signal for SRY (Red) on terminal region of one X chromosome in all the metaphases analyzed (Figure 3).
The male-differentiated structures in one streak gonad suggested the influence of SRY during gonad development, which ultimately led to gonadectomy.
[8] Human genes: SRY, sex determining region Y; SRD5A1, steroid 5 [alpha]-reductase 1; SRD5A2, steroid 5 [alpha]-reductase 2.
At the gene level, mutations in the SRY, SOX9, DMRT1 and DAX1 genes have been reported as causes of ovotesticular DSD (3,4,5,7).
For humans, PCR-based techniques for AMEL, SRY, and DYS14 have been implemented to determine the embryo's sex after implantation; however, these methods require a significant amount of genomic DNA.
Identification of a new mutation in the SRY gene in a 46, XY woman with Swyer syndrome.
En ninguna de las muestras analizadas con los cebadores SRY especificos se logro determinar el sexo.
Maciel-Guerra et al., "Novel mutations affecting SRY DNA-binding activity: the HMG box N65H associated with 46,XY pure gonadal dysgenesis and the familial non-HMG box R30I associated with variable phenotypes," Journal of Molecular Medicine, vol.
Multiplex B: SRY: 472 bp, sY254: 400 bp (AZFc), sY86: 320 bp (AZFa), sY127: 274 bp (AZFb)
This pattern is comparable to another Y-chromosomelinked functional gene, the male sex determining locus, SRY (Tucker and Lundrigan 1993; Whiteld, Lovell-Badge, and Good fellow 1993; Pamilo and O'Neill 1997; Wang, Zhang, and Zhang 2002, Hussain et al.
At this step, two pairs of primers were used: one to amplify a fragment of DXNds3 gene, a polymorphic microsatellite in Balb/c (244/270bp; forward: 3' GAGTGCCTCATCTATACTTACAG3'; reverse: 3 'TCTAGTTCATTGTTGATTAGTTGC3'; KUNIED A et al., 1992), which allows the evaluation of DNA template viability in the first electrophoretic run; and another (SRYout), designed to amplify the external fragment (300bp) of the SRY gene ENSMUSG00000069036; (forward: 5'CGCCCCATGAATGCATTTAT3'; reverse: 3'CCTGTCCCACTGCAGAAGGT3'), being accepted that this fragment does not appear at the first electrophoretic analysis, considering that a low concentration of allogeneic cells may be present in the samples of blood and lungs from recipients.
In this technique, fluorescent labeled-Taqman probes are used to detect DNA sequences on each sex chromosome in two separate reaction tubes, one specific for bovine proteolipid protein (PLP) gene located on the X chromosome and another for sex-determining region Y (SRY) located on the Y chromosome.