Inhibitor

(redirected from Serpin)
Also found in: Dictionary, Thesaurus, Medical, Legal, Wikipedia.

inhibitor

[in′hib·əd·ər]
(aerospace engineering)
A substance bonded, taped, or dip-dried onto a solid propellant to restrict the burning surface and to give direction to the burning process.
(chemistry)
A substance which is capable of stopping or retarding a chemical reaction; to be technically useful, it must be effective in low concentration.

Inhibitor

 

a circuit having m + n inputs and a single output, at which a signal can appear only when there are no signals on the m inputs (inhibiting). The other n inputs (principal) form one of the two logic connections, “AND” or “OR.” Inhibitors are used extensively in computers. They are very often understood to be a circuit having a single principal input and a single inhibiting input. A signal appears at the output of such a circuit when a signal is present on the principal input but there is none on the inhibiting input. Such an inhibitor is called an anticoincidence gate; its conventional representation is given in Figure 1.

Figure 1. Block diagram of an anticoincidence gate (inhibitor) with m — 1 and n 1:(A) principal input, (Q) inhibiting input, (Ga) anticoincidence gate

inhibitor

A substance added to paint to retard drying, skinning, mildew growth, etc. Also see corrosion inhibitor, inhibiting pigment, drying inhibitor.
References in periodicals archive ?
Serpins, immunity and autoimmunity: Old molecules, new functions.
japonicum] 6302 CE PREDICTED: similar to Actin-87E isoform 1 [Apis mellifera] 9304 CE SJCHGC05011 protein [Schistosoma japonicum]=similar to T-complex protein 1 subunit gamma (BLAST) 1302 CE unknown [Schistosoma mansoni] = Serpin (BLAST) 602 CE protein disulfide isomerase homologue [Schistosoma mansoni] 603 CE protein disulfide isomerase homologue [Schistosoma mansoni] 2301 CE unknown [Schistosoma mansoni] = Serpin (BLAST) 601 CE protein disulfide isomerase homologue [Schistosoma mansoni] 2602 CE HSP70 [Schistosoma japonicum] 8301 CE glutathione S-transferase omega [Schistosoma mansoni] 4302 CE actin [Schistosoma japonicum]-C terminal fragment 2601 CE SJCHGC09424 protein [S.
Thirty-six serpins are known to exist in humans (including antithrombin, kinin, some coagulation factors) among the over 1000 known, including those of fungi, bacteria, and certain viruses.
Target NCBI# Forward Heliomicin FJ546343 TGTCAACTACACCTCCGACTGCAA Virescein FJ546342 TTGTTGTGATTGCTCTGCTGGTGC Heliocin FJ546346 TGATCATCCGATCCTGCCTTCAGT Gloverin FJ546344 AACCGATGGAATGGTTCCAGGCT Hv-3-Tox FJ161976 TTTCCGAAATGCAGAAGGAGTGCC Serpin FJ577645 GCATCATCGGACCTGGCAATTGAT HvRPL4 EU523116 AGATGCTGAACGTGGACAAGCTGA Target Reverse Reference Heliomicin TCGCACCAACAGTTGCACTTAGCG This report Virescein CCGGAGTCCTTTGCCAATTGCTTT Bulet et al.
The serpin proteinase inhibitor 9 is an endogenous inhibitor of interleukin 1beta-converting enzyme (caspase-1) activity in human vascular smooth muscle cells.
M152R encodes an atypical serpin, the deletion of which triggers an attenuation of virulence in rabbit, associated with the absence of secondary myxomas (28).
confusa 1 AMMKAEVDEMLPGAA - ~720 chymotrypsin inhibitor Taeniopygia guttata 74 NMMKAEVDLYLPKLK 60 189 serine (or cysteine) protease inhibitor Bos taurus serpin 86 NMGKREVDLYLPRFK 40 394 peptidase inhibitor A.
Molecular and cellular aspects of the serpinopathies and disorders in serpin activity.
2014) showed that the fraction Am-2 discretely affected the normal APTT, as in the present study (data not shown); however, it had an independent effect of serpin (antithrombin and heparin cofactor II) for in vivo thrombosis inhibition.
Maspin, the product of a candidate tumor suppressor gene related to the serpin family of protease inhibitors, is intensely expressed in MECs of mammary gland.