VP7


Also found in: Acronyms, Wikipedia.

VP7

(Video Processor 7) See On2.
Copyright © 1981-2019 by The Computer Language Company Inc. All Rights reserved. THIS DEFINITION IS FOR PERSONAL USE ONLY. All other reproduction is strictly prohibited without permission from the publisher.
References in periodicals archive ?
PCR for amplification of VP4 and VP7 gene of RV: For amplification of VP4 and VP7 genes of RV, the viral RNA was extracted from collected faecal samples using RNA Sure(r) Virus Kit (Genetix, Asia Biotech Pvt.
Se utilizaron los primers (cebadores) descritos por Gouvea (25): Beg9 (5'GGCTTTAAAAGAGAGAATTTCCGTCTGG3') y End 9 (5'GGTCACATCATACAATTCTAATCTAAG3') para amplificar el gen de la proteina VP7 y la mezcla de los siguientes primers para la tipificacion G, BT1(G1): 5'CAAGTACTCAAATCAATGATGG3', CT2 (G2): 5'CAATGATATTAACACATTTTCTGTG3', ET3(G3): 5'CGTTTGAAGAAGTTGCAACAG3', DT4(G4): 5'CGTTTCTGGTGAGG AGTTG3', AT8(G8): 5'GTCACACCATTTGTAAATTCG 3', FT9(G9): 5'CTAGATGTAACTACAACTAC3', y RVG9: 5'GGTCACATCATACAATTCT3'.
Neutralization by focus reduction assays showed that the vaccine induced high titer of neutralizing antibodies against the porcine and non-porcine serotypes by efficient way and this response could be directed against VP4 and/or VP7 antigens.
A duplex RT-PCR assay for detection of genome segment 7 (VP7 gene) from 24 BTV serotypes.
The outer layer is constituted by trimeric structures of VP7 glycoprotein and the dimeric spikes of VP4 forming the triple-layered particles (TLP), the infectious form of the virus.
This includes VP6, which was the "it" codec for Flash before H.264, and VP7, which was used in Skype and by Move Networks.
The VP7 gene of rotavirus strain To14-0 shared the highest nucleotide identity with the VP7 genes of human G8P[8] strains from Southeast Asia, including strains RVN1149 and NP-130 (99.4% and 99.7% identity, respectively), and it shared slightly lower identity to the VP7 gene of human strain 04-97s379 (97.8%) from Taiwan, which is speculated to be of bovine origin (8) (Figure 2).