Encyclopedia

Kra

Also found in: Dictionary, Medical, Acronyms, Wikipedia.
(redirected from KRAS)

Kra

Isthmus of. an isthmus of SW Thailand, between the Bay of Bengal and the Gulf of Siam: the narrowest part of the Malay Peninsula. Width: about 56 km (35 miles)
Collins Discovery Encyclopedia, 1st edition © HarperCollins Publishers 2005
Mentioned in
References in periodicals archive
ELI-002 is an "AMP KRAS vaccine" containing seven Amphiphile mKRAS peptides and a proprietary Amphiphile adjuvant, administered subcutaneously.
Pyrosequencing for detection of KRAS mutation at codons 12 and 13 was conducted by using the Pyromark Q24 KRAS v2.0 Kit according to the manufacturer's protocol (Qiagen, Valencia, California).
Under the Phase 1/2 clinical trial, the company will evaluate MRTX849 as a single agent in patients with advanced solid tumours that harbor KRAS G12C mutations.
class="MsoNormalNecessary action will be taken on any other KRA staff found culpable during the ongoing investigations on the irregular sale of the ethanol.
KRAS mutations in cfDNA extracted from plasma and genomic DNA extracted from tissues were detected by droplet digital PCR (ddPCR) on a QX200 Droplet Digital PCR System (Bio-Rad Laboratories) using a KRAS screening multiplex ddPCR Kit, which covers 7 common KRAS mutations (G12A, G12C, G12D, G12R, G12S, G12V, and G13D).
As she was found to be positive for both KRAS and BRAF, she was not considered a candidate for anti-EGFR treatment.
Key words: Colorectal adenocarcinoma, KRAS mutations, Northern Pakistan.
No study, however, had correlated KRAS with the survival rate of metastatic colorectal cancer patients.
"KRAS has been widely regarded as an undruggable protein, but we show that that's simply not the case," said Pecot, the study lead author and member of the UNC Lineberger Comprehensive Cancer Center.
Forward and reverse primers used for exon 1 of Kras are shown below: KF 5'gactgaatataaacttgtgg 3' KR 5'ctgtatcaaagaagtgtcct 3' PCR cycling conditions included initial denaturation at 94degC for 5 min; followed by 35 cycles each comprising denaturation at 94degC for 30 s; 30 s of annealing at 54degC for exon 5, 56degC for exon 6, 58degC for exon 7, 58degC for exon 8 of P53 and 56degC for exon 1 of Kras; extension at 72degC for 30 s; final extension at 72degC for 7 min.
QIAGEN currently markets therascreen assays in Europe for biomarkers including KRAS, EGFR, NRAS, BRAF, PI3K, JAK2, MGMT and UGT1A1.
Copyright © 2003-2025 Farlex, Inc Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.