Eubacterium

(redirected from eubacteria)
Also found in: Dictionary, Thesaurus, Medical, Wikipedia.
Related to eubacteria: archaebacteria

Eubacterium

[‚yü·bak′tir·ē·əm]
(microbiology)
A genus of bacteria in the family Propionibacteriaceae; obligate anaerobes producing a mixture of organic acids (butyric, acetic, formic, and lactic) from carbohydrates and peptone.
References in periodicals archive ?
PCR primers Configuration Archaea 46F 5'-YTAAGCCATGCRAGT -3' 1100R 5'-YGGGTCTCGCTCGTTRCC -3' 340FGC 5'-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGG CACGGGGGGCCCTACGGGG(C/T)GCA(G/C)CAG -3' Eubacteria 340F 5'-CCCTACGGGYGCASCAG -3' 519R 5'-TTACCGCGGCKGCTG -3' 341F 5'-CCTACGGGAGGCAGCAG -3' 907R 5'-CCGTCAATTCCTTTRAGTTT -3' 341FGC 5'-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCAC 534R GGGGGGCCTACGGGAGGCAGCAG -3' 5' -ATTACCGCGGCTGCTGG -3' Table 3.
Both eubacteria and archaea are found among the "mineral-eating" microorganisms, those that, for example, oxidize Fe(II) minerals into ferric iron, Fe(III).
radiata Archaea - - - Eubacteria + + + Fungi - - - Helicosporidia - - - Microsporidia - - - Yeast-like symbiont - - - Wolbachia (wsp) + + - Bacteriophage WO + - -
However, direct effects of prebiotics and secondary metabolites such as tannin, saponin and natural resin on methanogens and eubacteria in the rumen remain to be elucidated to secure the safety for animals, their products and environment.
Although much attention is focused on resistance patterns of eubacteria (6), resistance is being found for virtually all microbial agents including mycobacteria (7,8), viruses (9,10), parasites (11,12), and fungi (13,14).
Scanning model for translational reinitiation in eubacteria.
The Institute for Genomic Research (TIGR) is a not-for-profit research institute whose primary research interests are in structural, functional and comparative analysis of genomes and gene products from a wide variety of organisms including viruses, eubacteria (both pathogens and non-pathogens), archaea (the so-called third domain of life), and eukaryotes (plants, animals, fungi and protists such as the malarial parasite).
Prokarya would include two kingdoms: Eubacteria and Archaebacteria
Calcium binds specifically and essentially to many proteins both within and between cells; to proteins of eubacteria, archae, and viruses; and is the essential constituent of many biominerals.
So far, more than 100 DNA sequences from 180 cultures in a group called eubacteria have been identified.
Although archaebacteria and eubacteria, Earth's two main bacterial groups, diverged almost from their inception nearly 4 billion years ago, they came back together about 1.
ARCHAEBACTERIA AND EUBACTERIA CONCENTRATIONS IN AQUATIC AREAS OF THREE DIVERSE SALINE ENVIRONMENTS.