glyceraldehyde


Also found in: Dictionary, Thesaurus, Medical, Wikipedia.
Related to glyceraldehyde: acetone

glyceraldehyde

[‚glis·ə′ral·də‚hīd]
(biochemistry)
CH2OHCOHCHO A colorless solid, isomeric with dehydroxyacetone; soluble in water and insoluble in organic solvents; an important intermediate in carbohydrate metabolism; used as a chemical intermediate in biochemical research and nutrition.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.
Mentioned in ?
References in periodicals archive ?
XBP1, X-box binding protein 1; usXBP1, un-spliced XBP1; sXBP1, spliced XBP1; RT-PCR, Reverse transcription polymerase chain reaction; qPCR, quantitative real-time polymerase chain reaction; ANOVA, analysis of variance; HSD, honestly significant difference; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
The effect of heat stress on frame switch splicing of X-box binding protein 1 gene in horse
ELISA: enzyme-linked immunosorbent assay; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; NF-[kappa]B: nuclear factor kappa B; TNF-[alpha]: tumor necrosis factor-alpha.
TNF-[alpha] inhibits SCF, ghrelin, and substance P expressions through the NF-[kappa]B pathway activation in interstitial cells of Cajal
Table 3 shows the results of the docking study between compounds 1-12 with the enzyme glyceraldehyde 3-phosphate dehydrogenase.
In silico Study of the Antichagasic Activity of Aromatic Compounds
(ANOVA followed by Bonferroni's test.) BZYQD: Bu-Zhong-Yi-Qi decoction; LC3: microtubule-associated protein light chain-3; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; 3-MA: 3-methyladenine.
Bu-Zhong-Yi-Qi Decoction, the Water Extract of Chinese Traditional Herbal Medicine, Enhances Cisplatin Cytotoxicity in A549/DDP Cells through Induction of Apoptosis and Autophagy
MicroRNA genes were measured relative to U6 and other genes relative to the housekeeping gene for glyceraldehyde 3-phosphate dehydrogenase.
Dendrosomal curcumin increases expression of the long non-coding RNA gene MEG3 via up-regulation of epi-miRs in hepatocellular cancer
ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.
ADAMTS12 depletion by insulin in OUMS-27 human chondrosarcoma cells
GAPDH detoxifies As using arsenate instead of phosphate converting glyceraldehyde 3-phosphate into 1-arseno-3-phospho-glycerate.
Enhanced photosynthesis and carbon metabolism favor arsenic tolerance in Artemisia annua, a medicinal plant as revealed by homology-based proteomics
Crystal structures of P falciparum glycolytic enzymes aldolase (PfALDO) [11], triosephosphate isomerase (PfTPI) [12], glyceraldehyde 3-phosphate dehydrogenase (PfGAPDH) [13], lactate dehydrogenase (PfLDH) [14], glucose 6-phosphate isomerase (PfGPI) (Gileadi et al.
Exploiting unique structural and functional properties of malarial glycolytic enzymes for antimalarial drug development
The synthesis of title compound initiates from a wellknown carbohydrate precursor (R)-2,3-isopropylidene glyceraldehyde 5, which can be easily prepared from commercially available D-mannitol [23-26].
Stereoselective synthesis of (+)-[alpha]-Conhydrine from R-(+)-glyceraldehyde
Con: control; BOO: bladder outlet obstruction; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.
Effect of detrusor overactivity on the expression of aquaporins and nitric oxide synthase in rat urinary bladder following bladder outlet obstruction
The genes of interest were glyceraldehyde 3-phosphate dehydrogenase (GAPDH, control), osteocalcin (BGLAP), transcription factor RunX2 (RunX), alkaline phosphatase (AP), and SMAD family member 4 (SMAD4) (Table 1).
Effects of multiwalled carbon nanotube reinforced collagen scaffolds on the osteogenic differentiation of mesenchymal stem cells
The glycolytic enzyme glyceraldehyde 3 phosphate dehydrogenase mediates nuclear cell death.
Actinidic archaea mediates biological transmutation in human systems-experimental evidence

Encyclopedia browser ?
Full browser ?