glyceraldehyde


Also found in: Dictionary, Thesaurus, Medical, Wikipedia.
Related to glyceraldehyde: acetone

glyceraldehyde

[‚glis·ə′ral·də‚hīd]
(biochemistry)
CH2OHCOHCHO A colorless solid, isomeric with dehydroxyacetone; soluble in water and insoluble in organic solvents; an important intermediate in carbohydrate metabolism; used as a chemical intermediate in biochemical research and nutrition.
References in periodicals archive ?
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H/R, hypoxia/reoxygenation; IP, immunoprecipitation.
ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.
MicroRNA genes were measured relative to U6 and other genes relative to the housekeeping gene for glyceraldehyde 3-phosphate dehydrogenase.
The membranes were blocked with either 50 g/L skim milk (Merck Chemicals) (for analysis of FUS and GFP) or 50 g/L BSA (Sigma-Aldrich) [for analysis of glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] prepared in TBS-T buffer (50 mmol/L Tris-HCl, pH 6.
Quantitative real time polymerase chain reaction (qRT-PCR) oligonucleotide primers for chicken lipopolysaccharide-induced tumor necrosis factor-a factor (LITAF), tumor necrosis factor superfamily 15 (TNFSF15), interleukin-8 (IL-8), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) internal control are listed in Table 2.
Primers for FOXO3a and the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were obtained from Invitrogen and are listed in [Table 2].
The methods and primers used for the reverse-transcription polymerase chain reaction (RT-PCR) analysis of mRNA representing the hsp 27, hsp 60, hsc 70, hsp 70A, hsp 70B, hsp 70C, and glyceraldehyde 3-phosphate dehydrogenase (g3pdh) genes have been described previously by this laboratory (Somji et al.
Fructose 6-phosphate and glyceraldehyde 3-phosphate derived from ribose 5-phosphate enter the glycolytic pathway rather than reverting to glucose 6-phosphate.
Quantitative real-time PCR (qRT-PCR) data of the target genes were normalized relative to glyceraldehyde 3-phosphate dehydrogenase expression and calculated using the 2-AACt method.
Antibodies against acetylated lysine and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were purchased from CST (Danvers, MA, USA).
To specifically identify virus replication, a multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) was used to simultaneously amplify glyceraldehyde 3 phosphate dehydrogenase (G3PDH), SARS-CoV genomic RNA (gRNA), and subgenomic RNA (sgRNA) (10).
Total RNA was isolated from confluent UROtsa cells grown on both serum-containing and serum-free growth medium and used to determine the basal expression of the respective heat shock protein genes relative to the glyceraldehyde 3-phosphate dehydrogenase (g3pdh) housekeeping gene using RTPCR technology as described previously (23-25).