XBP1, X-box binding protein 1; usXBP1, un-spliced XBP1; sXBP1, spliced XBP1; RT-PCR, Reverse transcription polymerase chain reaction; qPCR, quantitative real-time polymerase chain reaction; ANOVA, analysis of variance; HSD, honestly significant difference; GAPDH,
glyceraldehyde 3-phosphate dehydrogenase.
ELISA: enzyme-linked immunosorbent assay; GAPDH:
glyceraldehyde 3-phosphate dehydrogenase; NF-[kappa]B: nuclear factor kappa B; TNF-[alpha]: tumor necrosis factor-alpha.
Table 3 shows the results of the docking study between compounds 1-12 with the enzyme
glyceraldehyde 3-phosphate dehydrogenase.
(ANOVA followed by Bonferroni's test.) BZYQD: Bu-Zhong-Yi-Qi decoction; LC3: microtubule-associated protein light chain-3; GAPDH:
glyceraldehyde 3-phosphate dehydrogenase; 3-MA: 3-methyladenine.
MicroRNA genes were measured relative to U6 and other genes relative to the housekeeping gene for
glyceraldehyde 3-phosphate dehydrogenase.
ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH:
Glyceraldehyde 3-phosphate dehydrogenase.
GAPDH detoxifies As using arsenate instead of phosphate converting
glyceraldehyde 3-phosphate into 1-arseno-3-phospho-glycerate.
Crystal structures of P falciparum glycolytic enzymes aldolase (PfALDO) [11], triosephosphate isomerase (PfTPI) [12],
glyceraldehyde 3-phosphate dehydrogenase (PfGAPDH) [13], lactate dehydrogenase (PfLDH) [14], glucose 6-phosphate isomerase (PfGPI) (Gileadi et al.
The synthesis of title compound initiates from a wellknown carbohydrate precursor (R)-2,3-isopropylidene
glyceraldehyde 5, which can be easily prepared from commercially available D-mannitol [23-26].
Con: control; BOO: bladder outlet obstruction; GAPDH:
glyceraldehyde 3-phosphate dehydrogenase.
The genes of interest were
glyceraldehyde 3-phosphate dehydrogenase (GAPDH, control), osteocalcin (BGLAP), transcription factor RunX2 (RunX), alkaline phosphatase (AP), and SMAD family member 4 (SMAD4) (Table 1).
The glycolytic enzyme
glyceraldehyde 3 phosphate dehydrogenase mediates nuclear cell death.