Knockdown


Also found in: Dictionary, Thesaurus, Medical, Idioms, Wikipedia.

Knockdown

 

the condition of a boxer after a blow in which he is judged by the referee to be unable to continue the match for several seconds. The command to resume the match is given only after a count of eight, and only if the athlete is able to continue. In personal championship fights in the USSR, the match is ended after the second knockdown.

References in periodicals archive ?
Similarly, a single low intravitreal dose of a siRNA conjugate targeting human TTR resulted in virtually complete knockdown of TTR protein in the NHP eye, with effects lasting for at least three months.
For further investigation, primary rat myocardial fibroblasts were transfected with empty lentivirus or an AAT knockdown lentivirus.
The influences of HULC knockdown on alterations of these proteins in LNCaP cells were consistent with that in PC3 cells (Figure 2B).
Enhanced Conversion of iCMs from CFs upon Knockdown of Ruvbl1, Bcor, Zrsr2, or Stag2.
The knockdown and overexpression of TUG1 in BxPC-3 and PANC-1 cells were achieved by transfection with lentivirus vector containing TUG1 shRNA (forward, 5'-GATCCGCTTGGCTTCTATTCTGAAT CCTTTCAAG AGAAGGATTCAGAATAGAAAGCCAAGCCAAGCTTT TTTG-3'; reverse, 5'-GCGAACCGAAGATAAGACTTA GGAAAGTTCTCTTCCTAAGTCTTATCTTCGGTTCG AAAAAAC-3'; GenePharma, Shanghai, China), The overexpression of TUG1 in SW1990 cells was achieved by transfection with the TUG1-pcDNA3.1 plasmid which constructed by Invitrogen (Invitrogen, CA, USA).
Zhang, "Lentivirus-mediated knockdown of tumor protein D52-like 2 inhibits glioma cell proliferation," Cell Mol Biol (Noisy-le-grand), vol.
Quizzed on Alvarez's power, Smith was unequivocal in his explanation to the knockdowns.
According to the company, the patisiran treatment achieved a sustained mean serum TTR knockdown at the 80% target level for over nine months, with an up to 89.6% knockdown achieved between doses.
This knockdown apparently broke Gill's willpower as actions of the Australian became nervous and hectic.
Clarkson battled back again and gained a knockdown of his own in the next, although Dickinson seemed to hit the floor after a push.