malic acid

(redirected from malate)
Also found in: Dictionary, Medical, Wikipedia.
Related to malate: malic acid, malate synthase

malic acid:

see Krebs cycleKrebs cycle,
series of chemical reactions carried out in the living cell; in most higher animals, including humans, it is essential for the oxidative metabolism of glucose and other simple sugars.
..... Click the link for more information.
The Columbia Electronic Encyclopedia™ Copyright © 2013, Columbia University Press. Licensed from Columbia University Press. All rights reserved.
The following article is from The Great Soviet Encyclopedia (1979). It might be outdated or ideologically biased.

Malic Acid


(also called hydroxysuccinic acid), HOOCCH2CH(OH)COOH, a dibasic hydroxycarboxylic acid. Malic acid takes the form of a colorless, hygroscopic, crystalline compound that is readily soluble in water and ethyl alcohol; it has a melting point of 100°C.

Malic acid was first isolated by K. Scheele, who in 1785 obtained it from unripe apples. The L-form of the acid is found in plants either in the free state or as acid salts; the presence of either the acid or salt makes possible the acid reaction of cell fluid. Fruits rich in malic acid include barberries, raspberries, apples, and the berries of the mountain ash; the vegetative organs of succulents, especially Crassulaceae, also contain considerable amounts of the acid. The tobacco plants Nicotiana rustica and Nicotiana tabacum contain the nicotine salts of the acid.

Malic acid is an intermediate in cell respiration—in the tricarboxylic acid cycle and its variant, the glyoxylate cycle. In plants containing considerable amounts of organic acids (for example, rhubarb, begonia, and dock), free ammonia is rendered harmless by the formation of the ammonium salts of organic acids, including malic acid. Malic acid is used by many microorganisms as an energy substrate or a source of carbon. It is formed as a by-product in various types of fermentation.

Malic acid is used in the production of fruit drinks and candies.


The Great Soviet Encyclopedia, 3rd Edition (1970-1979). © 2010 The Gale Group, Inc. All rights reserved.

malic acid

[′mal·ik ′as·əd]
COOH·CH2·CHOH·COOH Hydroxysuccinic acid: a dibasic hydroxy acid existing in two optically active isomers and a racemate form; found in apples and many other fruits.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.
References in periodicals archive ?
718, Malate, Manila which is still inhabited by 20 informal settler families (ISFs) who belong to the original 70 ISFs scheduled for relocation in Caloocan City.
The first identified member of the ALMT family (Aluminum-activated malate transporter) was TaALMT1, discovered in the tips of the roots of wheat expressing a constitutively expressed transmembrane protein (SASAKI et al., 2004).
In C4 plants like maize, CO2 is primarily fixed to form malate in MC and then transferred into bundle sheath cells (BSC) by the C4 pathway to generate NADPH and release CO2, which is reduced by Calvin cycle.
The company added that it was the first applicant to submit an Abbreviated New Drug Application (ANDA) for almotriptan malate tablets containing a Paragraph IV patent certification for Janssen Pharmaceuticals Axert.
This study determined calcium contents and sensory attributes of all-purpose roasted and ground coffee fortified with calcium carbonate, calcium citrate malate, and calcium phosphate.
The encoding gene, malate dehydrogenase (mdh), was amplified by polymerase chain reaction (PCR) using primers MDH-F (5' CGCGGATCCATGGCACGCAACAAGATTG 3') and MDH-R (5' CGCGTCGACTTATTTCAGCGACGGAGCA 37) and subjected to the sequence analysis.
Teaming up with another veteran Johnny Malate, ace guard Bryan Solis and rookies Mark Concepcion and Keith Morabe, Butito made back-to-back baskets for an 18-point lead 50-32 and made RRJM scoreless in a two-minute mark.
More than a hundred people turned up at the Malate church in Manila for the annual event held near the feast day of St Francis of Assisi.
Albion Human Nutrition, Saint Clair Shores, Ml, has received CAS numbers for two of its products: DimaCal (DiCalcium malate), which is Generally Recognized As Safe (GRAS) and Di-Magnesium Malate.
G-F Malate Crown Plaza, Adriatico cor., 558 San Andres Sts., Malate, Manila
Both fumarate and malate, which are propionate precursors in the succinate to propionate pathway, act as [H.sub.2] acceptors (Callaway and Martin, 1996; Castillo et al., 2004).
The study, conducted by researchers at the University of California, San Francisco, suggests that the citrate and malate content in commonly consumed sodas may be sufficient to inhibit the development of calcium stones.