mtDNA


Also found in: Dictionary, Thesaurus, Medical, Legal, Acronyms, Wikipedia.
References in periodicals archive ?
The mitochondrial depletion syndromes (MDSs) are a clinically heterogeneous group of mitochondrial disorders characterized by a severe quantitative reduction of total mtDNA copy number.
The oocyte level of ROS, TFAM gene expression, mtDNA copy number and mitochondrial enzymes activity in both groups were assessed and compared.
A 1051 bp segment encompassing the mtDNA D-loop region was PCR-amplified by using a forward primer (5'AACAACCAACCTCCCCAAGA) and a reverse (5'TCAGTGCCTTGCTTTGGTTT) primer set.
2013) suggested that the Indonesian native Magelang duck population, which showed high polymorphism in the mtDNA D-loop region, might have originated from native ducks crossbreeding.
Levels of mtDNA can be quickly measured using polymerase chain reaction.
Importantly, an mtDNA quantity threshold was established, above which implantation was never observed.
We hypothesized that sperm mtDNA is vulnerable to damage and mutations may be associated to infertility.
However, few studies have focused on low-dose MeHg-induced alternations in mitochondrial mtDNA and the investigation of the underlying mechanisms involved in low-dose MeHg-induced toxicity is required.
Discordance between mtDNA and nDNA is not uncommon because the two genomes are exposed to different selective pressures and have different effective population sizes and modes of inheritance.
Many papers have provided insight into possible cures for human mtDNA disorders via transfer of nuclear material into donated oocytes with healthy mitochondria, or the introduction of healthy donor mitochondria into the affected oocytes, using assisted reproductive technology (ART) techniques involving micromanipulation.