osteogenesis

(redirected from osteogenetic)
Also found in: Dictionary, Medical.

osteogenesis

[¦äs·tē·ō′jen·ə·səs]
(physiology)
Formation or histogenesis of bone.
Mentioned in ?
References in periodicals archive ?
(8) Considering the size of the graft and the time necessary for remodeling and formation of osteogenetic potential in the presented case, the decision was made to place the implants subsequently, at least after 6 months.
Delayed segmental implant-supported over denture for a patient with partially resected mandible due to ameloblastoma
Osteogenetic effects of resveratrol in vitro: potential for the prevention and treatment of osteoporosis.
The prevalence of osteoporosis in the thrace region of Turkey: a community-based study/Turkiye'nin trakya bolgesinde osteoporoz prevalansi: toplum temelli bir calisma
In particular, bones are known to generate electricity in response to stress, and it has been hypothesised that this is due to strain gradients; if demonstrated, this would represent a significant step towards osteogenetic implants.
Spain : Flexoelectricity
Gene Forward (5'-3') Reverse (5'-3') Runx2 aaatgcctccgctgt gctccggcccacaaatct COLI acgtcctggcgaagttg cagggaagcctctttctcct OCN aagcaggagggcaataaggt agctgctgtgacatcccatac GAPDH ctgccaaatatgatgaca cccaggatgcccttga Effect of neoeriocitrin on PD98059 induced inhibition of osteogenetic differentiation
Comparison of neoeriocitrin and naringin on proliferation and osteogenic differentiation in MC3T3-E1
They function as a barrier for certain ions, induced osteogenetic cells.
Bone as a collagen-hydroxyapatite composite and its repair
Friedenstein, "Osteogenetic activity of transplanted transitional epithelium," Cells Tissues Organs, vol.
Human Bone Marrow Contains Mesenchymal Stromal Stem Cells That Differentiate In Vitro into Contractile Myofibroblasts Controlling T Lymphocyte Proliferation
The proliferation of osteoblastic cells cultured on Ti[O.sub.2]/HA-P composites nanofiber mat was slightly higher than that on Ti[O.sub.2]/HA composite nanofiber mat, indicating that PDA immobilization was not toxic to osteoblasts, highlighting the favorable microenvironment for osteogenetic ability.
Fabrication of pamidronic acid-immobilized Ti[O.sub.2]/hydroxyapatite composite nanofiber mats for biomedical applications

Encyclopedia browser ?
Full browser ?