(8) Considering the size of the graft and the time necessary for remodeling and formation of
osteogenetic potential in the presented case, the decision was made to place the implants subsequently, at least after 6 months.
Osteogenetic effects of resveratrol in vitro: potential for the prevention and treatment of osteoporosis.
Gene Forward (5'-3') Reverse (5'-3') Runx2 aaatgcctccgctgt gctccggcccacaaatct COLI acgtcctggcgaagttg cagggaagcctctttctcct OCN aagcaggagggcaataaggt agctgctgtgacatcccatac GAPDH ctgccaaatatgatgaca cccaggatgcccttga Effect of neoeriocitrin on PD98059 induced inhibition of
osteogenetic differentiation
They function as a barrier for certain ions, induced
osteogenetic cells.
Friedenstein, "
Osteogenetic activity of transplanted transitional epithelium," Cells Tissues Organs, vol.
The proliferation of osteoblastic cells cultured on Ti[O.sub.2]/HA-P composites nanofiber mat was slightly higher than that on Ti[O.sub.2]/HA composite nanofiber mat, indicating that PDA immobilization was not toxic to osteoblasts, highlighting the favorable microenvironment for
osteogenetic ability.