osteogenesis

(redirected from osteogenetic)
Also found in: Dictionary, Medical.

osteogenesis

[¦äs·tē·ō′jen·ə·səs]
(physiology)
Formation or histogenesis of bone.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.
References in periodicals archive ?
(8) Considering the size of the graft and the time necessary for remodeling and formation of osteogenetic potential in the presented case, the decision was made to place the implants subsequently, at least after 6 months.
Gene Forward (5'-3') Reverse (5'-3') Runx2 aaatgcctccgctgt gctccggcccacaaatct COLI acgtcctggcgaagttg cagggaagcctctttctcct OCN aagcaggagggcaataaggt agctgctgtgacatcccatac GAPDH ctgccaaatatgatgaca cccaggatgcccttga Effect of neoeriocitrin on PD98059 induced inhibition of osteogenetic differentiation
They function as a barrier for certain ions, induced osteogenetic cells.
Friedenstein, "Osteogenetic activity of transplanted transitional epithelium," Cells Tissues Organs, vol.
The proliferation of osteoblastic cells cultured on Ti[O.sub.2]/HA-P composites nanofiber mat was slightly higher than that on Ti[O.sub.2]/HA composite nanofiber mat, indicating that PDA immobilization was not toxic to osteoblasts, highlighting the favorable microenvironment for osteogenetic ability.

Full browser ?