osteogenesis

(redirected from osteogenetic)
Also found in: Dictionary, Medical.

osteogenesis

[¦äs·tē·ō′jen·ə·səs]
(physiology)
Formation or histogenesis of bone.
References in periodicals archive ?
(8) Considering the size of the graft and the time necessary for remodeling and formation of osteogenetic potential in the presented case, the decision was made to place the implants subsequently, at least after 6 months.
In particular, bones are known to generate electricity in response to stress, and it has been hypothesised that this is due to strain gradients; if demonstrated, this would represent a significant step towards osteogenetic implants.
Gene Forward (5'-3') Reverse (5'-3') Runx2 aaatgcctccgctgt gctccggcccacaaatct COLI acgtcctggcgaagttg cagggaagcctctttctcct OCN aagcaggagggcaataaggt agctgctgtgacatcccatac GAPDH ctgccaaatatgatgaca cccaggatgcccttga Effect of neoeriocitrin on PD98059 induced inhibition of osteogenetic differentiation
They function as a barrier for certain ions, induced osteogenetic cells.
Friedenstein, "Osteogenetic activity of transplanted transitional epithelium," Cells Tissues Organs, vol.
The proliferation of osteoblastic cells cultured on Ti[O.sub.2]/HA-P composites nanofiber mat was slightly higher than that on Ti[O.sub.2]/HA composite nanofiber mat, indicating that PDA immobilization was not toxic to osteoblasts, highlighting the favorable microenvironment for osteogenetic ability.

Full browser ?