submaxillary gland


Also found in: Dictionary, Thesaurus, Medical, Wikipedia.
Related to submaxillary gland: submaxillary salivary gland, submandibular gland

submaxillary gland

[¦səb′mak·sə‚ler·ē ‚gland]
References in periodicals archive ?
A study on the localization and distribution of GnRH and its receptor in rat submaxillary glands by immunohistochemical, in situ hybridization and RT-PCR.
Ovine submaxillary gland mucin (OSM) was purified from frozen glands as described (23), omitting the hydroxyapatite chromatographic step and including protease inhibitors (Chelex 100 and phenyl-methane-sulfonyl-fluoride) in the initial stages of purification.
33965 AGAGTGCCTCTCTGTCCAGAAGTCAATCCA Rattus norvegicus AGAAGTGCTTAATGGGTTCCT submaxillary gland alpha-2[micro] globulin mRNA, complete cds /cds=158,603) /gb= J00738 /gi=204262 /[micro]g=Rn.10203 /len=1003 (a) From UniGene (http://www.ncbi.nih.gov/UniGene/).
The tumor was located in a submaxillary gland. This particular anatomic site is notoriously unusual, with only 4 cases of salivary gland involvement reported in the literature to date, all of them in the parotid gland.[5,6]
(11.) Dockerty M B, Mayo C W 1942: Primary tumors of the submaxillary gland with special reference to mixed tumors.: SurgGyenecolobstet: 75:1033-45.