
Also found in: Dictionary, Medical, Wikipedia.
Related to tubulin: alpha tubulin


A globular protein containing two subunits; 10-14 molecules are arranged to form a microtubule.
McGraw-Hill Dictionary of Scientific & Technical Terms, 6E, Copyright © 2003 by The McGraw-Hill Companies, Inc.
References in periodicals archive ?
merolae lacks a typical cytoskeleton, the tubulin function in this organism is mostly limited to the formation of mitotic spindles.
TUBB3 and K1F21A primer sequences for conventional PCR Gene (exon/s) Forward sequence Reverse sequence tubulin beta-i(l) CAGCTCCTCTGGGAGACA CATCCCTTTGTTGCAGGTT tubulin beta-3(2) GAGGGCTAAAAGGCTTCACA GGTGCTGAGACCTGGTCAGT tubulin beta-3(3) CGGGCACAGAATTCAGAAA TCATGTGAGGAGCTGACCAT tubulin beta-3(4) TGCCCTTGGGATGTTCAG GGGATCCACTCCACGAAGTA tubulin bcta-3(4) GTTCGATGCCAAGAACATGA AGCTCTTCTTGCCTGTCCAC K1F21A(8) TTTTAGCATTTTAGGTGCTTTT AAAGTGCCAGCCTTAGATGT KIF21A(20-21) TGTTGTACTTAAATGAAAAAATGGCTC AGAGAAATCTGAAAAGCAAGCAGG Gene (exon/s) Amplicon size tubulin beta-i(l) 485 bp tubulin beta-3(2) 272 bp tubulin beta-3(3) 300 bp tubulin beta-3(4) 846 bp tubulin bcta-3(4) 862 bp K1F21A(8) 306 bp KIF21A(20-21) 794 bp
Microtubules are the key components of the cytoskeleton of eukaryotic cells and have an important role in various cellular functions such as intracellular migration and transport, cell shape maintenance, polarity, cell signaling, and mitosis.5 The real biologic basis by which tubulin inhibition would result in termination of a sustained monomorphic arrhythmia; cannot be fully explained.
Duocarmycins are able to exert their mode of action at any phase in the cellular cycle, whereas tubulin binders will only attack tumor cells when they are in a mitotic phase.
This distinction was not possible because of the limitations of gamma tubulin staining.
Immunohistochemical staining of Tubulin after fixation with NBF, Alcoholic Formaline, AFA, Bouin's, Carnoy's and Clarke's solutions.
Single cell suspensions were then stained with appropriate antibodies as follows: mouse antinestin (1: 50, Abcam), rat anti-CXCR4 (1: 50, BioLegend), and rabbit anti-[beta]III tubulin (1: 10, Epitomics).
A complete transcriptome analysis on biopsies of DMD patients has also revealed an upregulation of several X-ROS-related transcripts, including NOX2 and nine different tubulin isoforms [28].
The article was found to contain images with the following concerns: There are irregularities in the background in Figures 1(a) and 1(b); the tubulin controls in Figures 1(a) and 1(b) are the same; Figure 3(b), Cyclin B (72 hrs) is the same as Figure 6(b), TGF betal (24 hrs); Figure 5(c), the lanes in the TGF-alpha rows at 6 hours and 72 hours do not align.
Our group has reported, for the first time, the presence of HDAC6 in sperm and demonstrated its tubulin specific deacetylase activity and its role in sperm motility in Holtzman rat [9].
Their topics include post-translational modifications of tubulin and cilia, the central apparatus of cilia and eukaryotic flagella, transition zone migration: a mechanism for cytoplasmic ciliogenesis and postaxonemal centriole elongation, primary cilia and mammalian hedgehog signaling, G-protein-coupled receptor signaling in cilia, ciliary mechanisms of cyst formation in polycystic kidney disease, sperm sensory signaling, cilia and ciliopathies in congenital heart disease, photoreceptor cilia and retinal ciliopathies, and the evolution of cilia.